ID: 1035805297

View in Genome Browser
Species Human (GRCh38)
Location 8:2448438-2448460
Sequence TAAGCTAGTTCAGCCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035805295_1035805297 15 Left 1035805295 8:2448400-2448422 CCAAAGGGCAGTATTTGGGGCAA No data
Right 1035805297 8:2448438-2448460 TAAGCTAGTTCAGCCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035805297 Original CRISPR TAAGCTAGTTCAGCCTGAGC TGG Intergenic
No off target data available for this crispr