ID: 1035805502

View in Genome Browser
Species Human (GRCh38)
Location 8:2449850-2449872
Sequence ATTCTGTTATGGGCGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035805502_1035805511 13 Left 1035805502 8:2449850-2449872 CCCTGCCCCGCCCATAACAGAAT No data
Right 1035805511 8:2449886-2449908 CCAAGTTTAGGAAAGCTGCCTGG No data
1035805502_1035805509 1 Left 1035805502 8:2449850-2449872 CCCTGCCCCGCCCATAACAGAAT No data
Right 1035805509 8:2449874-2449896 TATAAAACATCTCCAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035805502 Original CRISPR ATTCTGTTATGGGCGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr