ID: 1035808868

View in Genome Browser
Species Human (GRCh38)
Location 8:2474617-2474639
Sequence GGCTCAGGGCCAGCTCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035808851_1035808868 25 Left 1035808851 8:2474569-2474591 CCACAGGCCGCCTGCTCCCTGTG No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808850_1035808868 26 Left 1035808850 8:2474568-2474590 CCCACAGGCCGCCTGCTCCCTGT No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808859_1035808868 8 Left 1035808859 8:2474586-2474608 CCTGTGCAGCGGGGGCTCCCTGT No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808853_1035808868 18 Left 1035808853 8:2474576-2474598 CCGCCTGCTCCCTGTGCAGCGGG No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808858_1035808868 9 Left 1035808858 8:2474585-2474607 CCCTGTGCAGCGGGGGCTCCCTG No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808857_1035808868 15 Left 1035808857 8:2474579-2474601 CCTGCTCCCTGTGCAGCGGGGGC No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808867_1035808868 -10 Left 1035808867 8:2474604-2474626 CCTGTGCAGCGGGGGCTCAGGGC No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data
1035808865_1035808868 -9 Left 1035808865 8:2474603-2474625 CCCTGTGCAGCGGGGGCTCAGGG No data
Right 1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035808868 Original CRISPR GGCTCAGGGCCAGCTCTACC TGG Intergenic
No off target data available for this crispr