ID: 1035814612

View in Genome Browser
Species Human (GRCh38)
Location 8:2526125-2526147
Sequence CAGGGATCTCAGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035814604_1035814612 8 Left 1035814604 8:2526094-2526116 CCTGAAGGAAACAGCTGTGTCAG No data
Right 1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG No data
1035814603_1035814612 9 Left 1035814603 8:2526093-2526115 CCCTGAAGGAAACAGCTGTGTCA No data
Right 1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG No data
1035814601_1035814612 17 Left 1035814601 8:2526085-2526107 CCCTGTTGCCCTGAAGGAAACAG No data
Right 1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG No data
1035814602_1035814612 16 Left 1035814602 8:2526086-2526108 CCTGTTGCCCTGAAGGAAACAGC No data
Right 1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035814612 Original CRISPR CAGGGATCTCAGAAGGATGA AGG Intergenic
No off target data available for this crispr