ID: 1035818122

View in Genome Browser
Species Human (GRCh38)
Location 8:2562321-2562343
Sequence CATGGTTTCCTGCACCGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035818122_1035818130 14 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818130 8:2562358-2562380 GGTCAGGGTCGTGCTGGCACAGG No data
1035818122_1035818124 -8 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818124 8:2562336-2562358 AAACCATGGCGATGTGCGAGAGG No data
1035818122_1035818131 18 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818131 8:2562362-2562384 AGGGTCGTGCTGGCACAGGTAGG No data
1035818122_1035818129 8 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818129 8:2562352-2562374 CGAGAGGGTCAGGGTCGTGCTGG No data
1035818122_1035818127 -2 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818127 8:2562342-2562364 TGGCGATGTGCGAGAGGGTCAGG No data
1035818122_1035818125 -7 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818125 8:2562337-2562359 AACCATGGCGATGTGCGAGAGGG No data
1035818122_1035818128 -1 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818128 8:2562343-2562365 GGCGATGTGCGAGAGGGTCAGGG No data
1035818122_1035818132 21 Left 1035818122 8:2562321-2562343 CCGTTGCGGTGCAGGAAACCATG No data
Right 1035818132 8:2562365-2562387 GTCGTGCTGGCACAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035818122 Original CRISPR CATGGTTTCCTGCACCGCAA CGG (reversed) Intergenic
No off target data available for this crispr