ID: 1035819786

View in Genome Browser
Species Human (GRCh38)
Location 8:2579028-2579050
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035819786_1035819791 19 Left 1035819786 8:2579028-2579050 CCATTCAGCTTCTGCTCATGAGT No data
Right 1035819791 8:2579070-2579092 TCTTTGATTTTGTTTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035819786 Original CRISPR ACTCATGAGCAGAAGCTGAA TGG (reversed) Intergenic
No off target data available for this crispr