ID: 1035825435

View in Genome Browser
Species Human (GRCh38)
Location 8:2639809-2639831
Sequence CTCCAAAACCAGTCAGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035825435_1035825445 11 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825445 8:2639843-2639865 GGAGGATAATGAAGGTCAAGGGG No data
1035825435_1035825441 -7 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825441 8:2639825-2639847 TTTGGAGATCGGGCTTTAGGAGG No data
1035825435_1035825443 9 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825443 8:2639841-2639863 TAGGAGGATAATGAAGGTCAAGG No data
1035825435_1035825440 -10 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825440 8:2639822-2639844 GGTTTTGGAGATCGGGCTTTAGG No data
1035825435_1035825444 10 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825444 8:2639842-2639864 AGGAGGATAATGAAGGTCAAGGG No data
1035825435_1035825447 13 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825447 8:2639845-2639867 AGGATAATGAAGGTCAAGGGGGG No data
1035825435_1035825448 25 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825448 8:2639857-2639879 GTCAAGGGGGGTAATAAGAGTGG No data
1035825435_1035825442 3 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825442 8:2639835-2639857 GGGCTTTAGGAGGATAATGAAGG No data
1035825435_1035825446 12 Left 1035825435 8:2639809-2639831 CCCCAGTCTGACTGGTTTTGGAG No data
Right 1035825446 8:2639844-2639866 GAGGATAATGAAGGTCAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035825435 Original CRISPR CTCCAAAACCAGTCAGACTG GGG (reversed) Intergenic
No off target data available for this crispr