ID: 1035826885

View in Genome Browser
Species Human (GRCh38)
Location 8:2654205-2654227
Sequence GTGTCAAAGGGGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035826885_1035826898 22 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826898 8:2654250-2654272 GACCCATGGACAGGTGGGCAGGG No data
1035826885_1035826899 23 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826899 8:2654251-2654273 ACCCATGGACAGGTGGGCAGGGG No data
1035826885_1035826896 17 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826896 8:2654245-2654267 AGTGAGACCCATGGACAGGTGGG No data
1035826885_1035826893 8 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826893 8:2654236-2654258 TGGGCACTCAGTGAGACCCATGG No data
1035826885_1035826902 29 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826902 8:2654257-2654279 GGACAGGTGGGCAGGGGAGAAGG No data
1035826885_1035826897 21 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826897 8:2654249-2654271 AGACCCATGGACAGGTGGGCAGG No data
1035826885_1035826895 16 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826895 8:2654244-2654266 CAGTGAGACCCATGGACAGGTGG No data
1035826885_1035826894 13 Left 1035826885 8:2654205-2654227 CCTCCCTCAATCCCCTTTGACAC No data
Right 1035826894 8:2654241-2654263 ACTCAGTGAGACCCATGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035826885 Original CRISPR GTGTCAAAGGGGATTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr