ID: 1035827384

View in Genome Browser
Species Human (GRCh38)
Location 8:2659529-2659551
Sequence TGTTTTCTGCAGCGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035827378_1035827384 -7 Left 1035827378 8:2659513-2659535 CCTGAAGGCACCTGCCTGTTTTC No data
Right 1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG No data
1035827376_1035827384 28 Left 1035827376 8:2659478-2659500 CCTTCGTTGAAATTACATTCGAG No data
Right 1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035827384 Original CRISPR TGTTTTCTGCAGCGGGTACA GGG Intergenic
No off target data available for this crispr