ID: 1035829293

View in Genome Browser
Species Human (GRCh38)
Location 8:2676908-2676930
Sequence CAAATACCTGTGGCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035829293_1035829296 2 Left 1035829293 8:2676908-2676930 CCACAGCAGGCCACAGGTATTTG No data
Right 1035829296 8:2676933-2676955 ATCACTGTCATTCATCCTTAGGG No data
1035829293_1035829295 1 Left 1035829293 8:2676908-2676930 CCACAGCAGGCCACAGGTATTTG No data
Right 1035829295 8:2676932-2676954 TATCACTGTCATTCATCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035829293 Original CRISPR CAAATACCTGTGGCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr