ID: 1035831615

View in Genome Browser
Species Human (GRCh38)
Location 8:2700999-2701021
Sequence CAGCACATCCGGCAGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035831612_1035831615 -4 Left 1035831612 8:2700980-2701002 CCAAGACACCTCTAGCTGTCAGC No data
Right 1035831615 8:2700999-2701021 CAGCACATCCGGCAGTTTTCTGG No data
1035831611_1035831615 -3 Left 1035831611 8:2700979-2701001 CCCAAGACACCTCTAGCTGTCAG No data
Right 1035831615 8:2700999-2701021 CAGCACATCCGGCAGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035831615 Original CRISPR CAGCACATCCGGCAGTTTTC TGG Intergenic
No off target data available for this crispr