ID: 1035835519

View in Genome Browser
Species Human (GRCh38)
Location 8:2747627-2747649
Sequence TCATATGTGGTGCACTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035835519_1035835522 8 Left 1035835519 8:2747627-2747649 CCCTTGTAGTGCACCACATATGA No data
Right 1035835522 8:2747658-2747680 ATGAATTAAAAACTACAGAATGG No data
1035835519_1035835523 9 Left 1035835519 8:2747627-2747649 CCCTTGTAGTGCACCACATATGA No data
Right 1035835523 8:2747659-2747681 TGAATTAAAAACTACAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035835519 Original CRISPR TCATATGTGGTGCACTACAA GGG (reversed) Intergenic
No off target data available for this crispr