ID: 1035838557

View in Genome Browser
Species Human (GRCh38)
Location 8:2786057-2786079
Sequence CTATGGAAACTACACATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035838551_1035838557 15 Left 1035838551 8:2786019-2786041 CCTGGCTGCCAAGTACGTGCATT No data
Right 1035838557 8:2786057-2786079 CTATGGAAACTACACATGGACGG No data
1035838552_1035838557 7 Left 1035838552 8:2786027-2786049 CCAAGTACGTGCATTGTAATTAG No data
Right 1035838557 8:2786057-2786079 CTATGGAAACTACACATGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035838557 Original CRISPR CTATGGAAACTACACATGGA CGG Intergenic
No off target data available for this crispr