ID: 1035842576

View in Genome Browser
Species Human (GRCh38)
Location 8:2828357-2828379
Sequence TTGAGTCTTTTCCTCCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035842571_1035842576 29 Left 1035842571 8:2828305-2828327 CCTACAAGTAAGACAGGGAGCTT No data
Right 1035842576 8:2828357-2828379 TTGAGTCTTTTCCTCCGTGAAGG No data
1035842573_1035842576 2 Left 1035842573 8:2828332-2828354 CCTGGTGTCATTTTCCATGAACC No data
Right 1035842576 8:2828357-2828379 TTGAGTCTTTTCCTCCGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035842576 Original CRISPR TTGAGTCTTTTCCTCCGTGA AGG Intergenic
No off target data available for this crispr