ID: 1035847666

View in Genome Browser
Species Human (GRCh38)
Location 8:2882662-2882684
Sequence CCCACTCAGCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035847666_1035847678 14 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847678 8:2882699-2882721 GGCATTTGGTTAGAATGGTTGGG No data
1035847666_1035847672 -7 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847672 8:2882678-2882700 GAGTGGGAGCCCAGGTGGTTTGG No data
1035847666_1035847679 24 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847679 8:2882709-2882731 TAGAATGGTTGGGTTGCCCTAGG No data
1035847666_1035847676 9 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847676 8:2882694-2882716 GGTTTGGCATTTGGTTAGAATGG No data
1035847666_1035847673 0 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847673 8:2882685-2882707 AGCCCAGGTGGTTTGGCATTTGG No data
1035847666_1035847677 13 Left 1035847666 8:2882662-2882684 CCATCCTCCTTCTGCTGAGTGGG No data
Right 1035847677 8:2882698-2882720 TGGCATTTGGTTAGAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035847666 Original CRISPR CCCACTCAGCAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr