ID: 1035848853

View in Genome Browser
Species Human (GRCh38)
Location 8:2894058-2894080
Sequence ACGTGGGGTCCTGGATGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035848853_1035848864 26 Left 1035848853 8:2894058-2894080 CCAAGACATCCAGGACCCCACGT No data
Right 1035848864 8:2894107-2894129 ACACCACCTCCAAGAAATCCAGG No data
1035848853_1035848865 27 Left 1035848853 8:2894058-2894080 CCAAGACATCCAGGACCCCACGT No data
Right 1035848865 8:2894108-2894130 CACCACCTCCAAGAAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035848853 Original CRISPR ACGTGGGGTCCTGGATGTCT TGG (reversed) Intergenic
No off target data available for this crispr