ID: 1035854124

View in Genome Browser
Species Human (GRCh38)
Location 8:2955479-2955501
Sequence AGCCTCATGCTCTTACTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035854124 Original CRISPR AGCCTCATGCTCTTACTTAT GGG Intronic
907376138 1:54042739-54042761 AGCTTAATTCTGTTACTTATTGG + Intronic
908692286 1:66795929-66795951 AACCTCATGTTCTCACTCATAGG - Intergenic
909287062 1:73832817-73832839 TGCTTCATGCTGTTATTTATGGG - Intergenic
910191531 1:84600871-84600893 AGCCCCATGCTCTTCCTGTTGGG - Intergenic
911336557 1:96588154-96588176 AGCCGCATGATCTAACTTTTGGG - Intergenic
912081549 1:105943536-105943558 AGCCCCATGTTCTCACTCATAGG - Intergenic
919239158 1:194889438-194889460 AGCCTCCTTCTCATACTTGTTGG - Intergenic
919357034 1:196537151-196537173 AGCCTCATCATCTTAATTCTAGG + Intronic
924612947 1:245588890-245588912 ACGTTCTTGCTCTTACTTATTGG + Intronic
1064024262 10:11834387-11834409 AGCCTCACGTTCTTACAGATCGG + Intronic
1064068790 10:12207334-12207356 AGCCTCCTGTTCTTCCTTAATGG + Intronic
1070529630 10:77325423-77325445 AGCCTCAAGCTCTGACTTTGGGG + Intronic
1071420082 10:85486503-85486525 TACCACATGCTCTCACTTATAGG - Intergenic
1073479724 10:103778903-103778925 GGCCTCATGCTCTTCCCTCTTGG - Intronic
1075828222 10:125378954-125378976 TGCCACATGTTCTCACTTATAGG - Intergenic
1081164999 11:39797697-39797719 CGCCGCATGTTCTTACTCATAGG - Intergenic
1085181699 11:74541985-74542007 AGCCTCATCATCTTAATTCTAGG - Intronic
1086283527 11:85218987-85219009 TACCACATGTTCTTACTTATAGG + Intronic
1086874491 11:92078440-92078462 CACCTCATGTTCTCACTTATAGG + Intergenic
1087343483 11:96938453-96938475 CACCCCATGCTCTCACTTATAGG - Intergenic
1087848056 11:102995643-102995665 AAACTTATGCTCTTCCTTATAGG - Intergenic
1087934266 11:104013697-104013719 AGCCTGATGCTTTTATATATGGG - Intronic
1091619896 12:2079042-2079064 CGCCACATGTTCTCACTTATAGG + Intronic
1092341747 12:7682481-7682503 AGACTCATGATCTTATTTAATGG - Intergenic
1095632323 12:44392751-44392773 AGCCGCATGTTCTCACTCATAGG - Intergenic
1098217390 12:68234802-68234824 ATCCTCATGCTCTATCTTCTGGG - Intergenic
1098233792 12:68398745-68398767 CGCCGCATGTTCTTACTCATAGG - Intergenic
1098448547 12:70592877-70592899 AGCCTTATGGTGTTTCTTATTGG + Intronic
1099097699 12:78396104-78396126 TGCCTCATGGTCTTTCTCATGGG + Intergenic
1099515801 12:83595458-83595480 CACCTCATGTTCTTACTCATAGG + Intergenic
1099801170 12:87458654-87458676 AGCCTCATACTTTCATTTATTGG + Intergenic
1099863343 12:88246781-88246803 AGCATCATGTTCTTACCTATAGG - Intergenic
1100033892 12:90226800-90226822 AGCCATATGCCTTTACTTATTGG - Intergenic
1100921280 12:99491017-99491039 AGCCTTAAGCTCTTACTTCATGG - Intronic
1102805862 12:115779772-115779794 TACCACATGTTCTTACTTATGGG + Intergenic
1105753248 13:23441268-23441290 AGCCTCATGCTCTTCTCTAATGG + Intergenic
1107311109 13:39079312-39079334 TGCCACATGTTCTCACTTATGGG + Intergenic
1109605294 13:64686682-64686704 AGCCTCTTCCTCTTCCTTATTGG + Intergenic
1109633511 13:65084399-65084421 TACTTCATGCTCTTACTTTTTGG - Intergenic
1109884935 13:68529423-68529445 TACCACATGTTCTTACTTATAGG + Intergenic
1110992173 13:82056193-82056215 CACCGCATGTTCTTACTTATTGG + Intergenic
1111142263 13:84134594-84134616 TGCCTCATGTTCTCACTCATAGG + Intergenic
1111435159 13:88196916-88196938 TGCTGCATGCTCTCACTTATAGG - Intergenic
1115804412 14:37034846-37034868 AGCCGAATGCTCTTCCTCATGGG - Intronic
1116755566 14:48943828-48943850 AGAATCATTCCCTTACTTATGGG + Intergenic
1122199527 14:100114051-100114073 AGCCTCATGCTCTCACTTGAAGG - Intronic
1122809065 14:104279073-104279095 ATCCTCATTCTCTTAATTATTGG - Intergenic
1127673574 15:61219047-61219069 AGTCTCATGCTCTGATTTAGTGG - Intronic
1128522616 15:68385837-68385859 AGCCTCATGATTTTACAGATGGG - Intronic
1130165795 15:81456776-81456798 GGTCTCAGGCTTTTACTTATTGG + Intergenic
1131936177 15:97508206-97508228 CACCTCATGTTCTCACTTATAGG + Intergenic
1134260800 16:12649363-12649385 AGCCTCTAGCTCTGGCTTATGGG + Intergenic
1135348658 16:21710572-21710594 AGCATCATCTTCTTACTGATTGG - Intronic
1137946635 16:52739162-52739184 TGCCACATGGCCTTACTTATAGG + Intergenic
1138753661 16:59455669-59455691 AGCATCACTCTCTGACTTATGGG + Intergenic
1150888994 17:69122926-69122948 AGCCTTATGTTCTCACTCATAGG + Intronic
1154327607 18:13403191-13403213 TGCCTCATGCTCCTACTCAGGGG - Intronic
1155819386 18:30354940-30354962 AGCCTGAAGCTCTTACTCACTGG - Intergenic
1155918578 18:31579976-31579998 AGCCTCATGGCCCTACTTAGAGG + Intergenic
1156442005 18:37200111-37200133 TGCCTCAGGCTCTTCCTTTTAGG - Intronic
1158111254 18:53943290-53943312 AGCCTCATCATCTTAATTCTAGG + Intergenic
1159068725 18:63598195-63598217 TACCTAATGCTCTTAATTATTGG + Exonic
1159743602 18:72204959-72204981 AGCCTCCTGCACTTGATTATAGG - Intergenic
1160310973 18:77789803-77789825 AACCTCATGTTCTCACTCATAGG + Intergenic
1166264159 19:41666866-41666888 AGCCGCATGTTCTCACTCATGGG - Intronic
925774871 2:7325077-7325099 AACCTCATGCACTTTCTTAAGGG + Intergenic
927119484 2:19942409-19942431 AGTCTCATGCACTTACATATTGG - Intronic
928506522 2:31959170-31959192 AGGCTCACACTCTTACTAATGGG - Intronic
928696431 2:33854377-33854399 AGCCTGAGGCACTTATTTATAGG - Intergenic
928851349 2:35750887-35750909 CACCTCATGTTCTCACTTATAGG + Intergenic
930961787 2:57271088-57271110 CGCCTCATGTTCTCACTCATAGG - Intergenic
931177340 2:59867337-59867359 AGCCTCATCCTCTGCCTTTTAGG - Intergenic
931848711 2:66231462-66231484 AGATTGATGCTCTTTCTTATGGG + Intergenic
932324453 2:70848076-70848098 CACCACATGCTCTCACTTATAGG + Intergenic
932659686 2:73641483-73641505 ACCCTCATACTCTTACTTGGGGG - Exonic
932666251 2:73701160-73701182 ACCCTCATACTCTTACTTGGGGG - Intergenic
932985636 2:76723063-76723085 CACCGCATGCTCTTACTCATAGG - Intergenic
933514059 2:83278473-83278495 ATCCTCATTCTCTTACCTGTAGG + Intergenic
935253897 2:101290997-101291019 AGCCACATGCTGATACTGATTGG - Intronic
935265646 2:101391637-101391659 AGCCTGATGCTGCTTCTTATAGG - Intergenic
936056383 2:109264985-109265007 AGCCGCATGCTCTGTCTTAGAGG + Intronic
939129772 2:138221206-138221228 GGTCTCATTCCCTTACTTATAGG + Intergenic
940711568 2:157168597-157168619 GGCCTCATGAGCTTACTCATAGG - Intergenic
942373483 2:175311297-175311319 ACCCTCCTGCTCTGACTTCTAGG - Intergenic
943587191 2:189755314-189755336 AGGCTCATGCACTTACTATTAGG - Exonic
944442929 2:199761011-199761033 AGTCACTTGCTCTCACTTATTGG + Intronic
1169679481 20:8194814-8194836 AGCCTCATACTTTTTCATATTGG + Intronic
1170143232 20:13146188-13146210 TACCACATGTTCTTACTTATAGG + Intronic
1173367945 20:42404614-42404636 AGCCTCTTGATTTTACTAATGGG - Intronic
1174698208 20:52581521-52581543 AGCCTCAGCCTCTTGCTCATTGG + Intergenic
1178215306 21:30590597-30590619 AGGCTCATGATTTTACTTGTTGG - Intergenic
1179588190 21:42387302-42387324 AGCCTCTTCCTCTGACTCATTGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951324946 3:21290331-21290353 AGCCTCCTCCACTTGCTTATTGG - Intergenic
952667856 3:35928971-35928993 AACCTCAAGCTCCTACATATGGG + Intergenic
953149865 3:40315068-40315090 AGCCTAATCCTCTGATTTATGGG - Intergenic
954029762 3:47810734-47810756 GACCTCATGCCCTTCCTTATTGG + Intronic
956048090 3:65217902-65217924 CACCTCATGTTCTCACTTATAGG - Intergenic
958094128 3:88919531-88919553 AGCCTCTTTCTGTTATTTATAGG - Intergenic
958117726 3:89242982-89243004 CACCGCATGTTCTTACTTATAGG - Intronic
959326733 3:104946248-104946270 TGCCTCATGTTCTCACTTACAGG - Intergenic
959846985 3:111044460-111044482 TACCTCATGCTCTTACTCATAGG + Intergenic
961196801 3:125009186-125009208 ACCTTCATGCTCTTGCTCATAGG - Intronic
962977559 3:140458975-140458997 TGGCTCATGCTCCTTCTTATGGG + Intronic
963773506 3:149414810-149414832 GCCCTCATGCTCTTTCTTTTTGG - Intergenic
964262341 3:154853406-154853428 CACCTCATGTTCTTACTCATAGG - Intergenic
965395320 3:168154905-168154927 AGTCTCATGCTCTGCCTTCTAGG + Intergenic
966872738 3:184301957-184301979 AGCCTCATGCTCTGCATTGTGGG - Exonic
967183588 3:186927556-186927578 AGCCTCTGCCTCTCACTTATAGG + Intergenic
967262826 3:187660885-187660907 TGCCACATGTTCTCACTTATAGG - Intergenic
969879431 4:10160867-10160889 TGCCTCTTGCTCTTACTCCTTGG + Intergenic
970119758 4:12740635-12740657 TGCCACATGTTCTTACTCATAGG + Intergenic
970416003 4:15857460-15857482 AACCACATGTTCTCACTTATAGG - Intergenic
972646195 4:40969857-40969879 AGCCTGATTCTATTACTTAAAGG - Intronic
973557432 4:52098712-52098734 AGCCTCTTGCCTTTAATTATAGG - Intergenic
974609529 4:64197946-64197968 AGCATCATACTCTTACTTGAAGG + Intergenic
974666201 4:64964938-64964960 TGCCGCATGTTCTCACTTATTGG - Intergenic
975480968 4:74879874-74879896 AGCCTCAGGCTCACATTTATTGG - Intergenic
976517486 4:85985394-85985416 TACCTCATGTTCTCACTTATAGG + Intronic
977977188 4:103279351-103279373 TGCCACATGTTCTCACTTATAGG - Intergenic
978254348 4:106675769-106675791 CACCACATGTTCTTACTTATAGG + Intergenic
980215128 4:129842789-129842811 CGCCTCATGCTCTCACTCATAGG - Intergenic
983683513 4:170380282-170380304 TACCACATGTTCTTACTTATAGG - Intergenic
984142793 4:176023736-176023758 AGACTCATTCTCTTCCTTAATGG - Intergenic
986496635 5:8348615-8348637 TGCCACATGTTCTCACTTATAGG + Intergenic
986914675 5:12604117-12604139 TCCCTCATGTTCTTACTTATAGG - Intergenic
994228421 5:97282849-97282871 TACCACATGTTCTTACTTATAGG - Intergenic
995697071 5:114891482-114891504 CACCACATGTTCTTACTTATAGG - Intergenic
995828946 5:116332760-116332782 CACCACATGTTCTTACTTATAGG + Intronic
997488819 5:134255321-134255343 AGGCTCATGATCATCCTTATAGG + Intergenic
1000235369 5:159354382-159354404 ACCCTCATGTGCTTACTTGTAGG - Intergenic
1001654862 5:173341485-173341507 TGCCTCACTCTCTTACGTATTGG + Intergenic
1001691643 5:173637308-173637330 AGCCTCATTTTGTTACTTTTTGG - Intergenic
1003788418 6:9514360-9514382 ACCATCATGCTGTTACTTGTTGG - Intergenic
1004239693 6:13909296-13909318 AGCCTCATGCCCTTTCTGATTGG - Intergenic
1004823751 6:19398535-19398557 AGCCCCATGCTATGACTTAAAGG + Intergenic
1008407872 6:51139281-51139303 AATATCATGCTCTTACTTATAGG + Intergenic
1008408310 6:51143888-51143910 AACCACATGTTCTCACTTATAGG + Intergenic
1010337950 6:74710763-74710785 AGACTCATGTTCTTTCTTTTGGG + Intergenic
1013634223 6:112013274-112013296 AGCCTCATTCTCATAATTTTAGG + Intergenic
1013809378 6:114027350-114027372 AGCCTGATTCTCTGACATATGGG - Intergenic
1014783919 6:125596511-125596533 AGGCTCATGCCCTTACCAATTGG + Intergenic
1020505263 7:8978620-8978642 TGCATCATGATCTCACTTATAGG - Intergenic
1022406457 7:30094753-30094775 CACCTCATGTTCTCACTTATAGG - Intronic
1024043157 7:45570436-45570458 TACCACATGTTCTTACTTATAGG + Intergenic
1028379006 7:90176994-90177016 AGCCTCATGCCCTTCCGAATTGG - Intronic
1031170293 7:118285043-118285065 CACCTCATGCTCTCACTCATAGG + Intergenic
1034216729 7:149413421-149413443 ATCCGCATGTTCTCACTTATAGG + Intergenic
1035854124 8:2955479-2955501 AGCCTCATGCTCTTACTTATGGG + Intronic
1035885399 8:3286054-3286076 CGCCTCATGTTCTCACTCATAGG - Intronic
1041314729 8:56549259-56549281 ATCCTCATGTTCTCACTCATAGG - Intergenic
1043412194 8:80009189-80009211 CACCTCATGTTCTTACTCATAGG + Intronic
1043819776 8:84847933-84847955 CTCCTCATGCTCTTACATAGAGG - Intronic
1044514839 8:93126056-93126078 ACCCTCATGCTCTTACACAATGG - Intergenic
1044718055 8:95119252-95119274 AGCCCCATGTTCTCACTCATAGG - Intergenic
1046201853 8:110937491-110937513 TGTCTCATGTTCTCACTTATAGG + Intergenic
1047859904 8:128954305-128954327 CACCTCATGTTCTCACTTATAGG - Intergenic
1050199518 9:3128824-3128846 ATCCTCATGCTTTTACATAAGGG - Intergenic
1051915438 9:22201181-22201203 AGCCTCTTGGTTTTATTTATTGG - Intergenic
1052049217 9:23825862-23825884 AGCTTCTTGCTCATCCTTATTGG - Exonic
1053750935 9:41253990-41254012 ACCCGCATGTTCTCACTTATAGG - Intergenic
1054256452 9:62818334-62818356 ACCCGCATGTTCTCACTTATAGG - Intergenic
1054334854 9:63797285-63797307 ACCCGCATGTTCTCACTTATAGG + Intergenic
1058491741 9:105508543-105508565 AGGCTCATACTCTTACTTTTGGG + Intronic
1203444623 Un_GL000219v1:44145-44167 AGGTTCATTCTTTTACTTATGGG + Intergenic
1187089458 X:16080062-16080084 AGCCACATGAGCTTACTTACAGG + Intergenic
1188722006 X:33533573-33533595 TGCCACATGTTCCTACTTATAGG + Intergenic
1190682883 X:52843705-52843727 CACCTCATGCTCTTATTTGTAGG - Intergenic
1192057959 X:67792231-67792253 AGCTTCATTCTTTTACTAATAGG + Intergenic
1193597685 X:83466805-83466827 CACCTCATGTTCTCACTTATAGG - Intergenic
1194999017 X:100623971-100623993 ACCCTCATGTTCTCACTCATAGG - Intergenic
1195264482 X:103166511-103166533 AGACTGATGATATTACTTATAGG - Intergenic
1196505895 X:116441408-116441430 AGTCTCATGCTCTAATTTAAAGG + Intronic
1197873955 X:131084713-131084735 CTCCTCCTGCTCTTTCTTATTGG - Intronic
1201604682 Y:15771844-15771866 AGCCACATTCTTTTACTTAAAGG - Intergenic