ID: 1035857426

View in Genome Browser
Species Human (GRCh38)
Location 8:2990992-2991014
Sequence CCATAGGGTATATTAGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035857417_1035857426 30 Left 1035857417 8:2990939-2990961 CCGCCTTTCCCACATTTCAATGT 0: 1
1: 0
2: 1
3: 23
4: 373
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data
1035857421_1035857426 -1 Left 1035857421 8:2990970-2990992 CCCTTCAGTTGTAGATTGCTTTC 0: 1
1: 0
2: 0
3: 14
4: 240
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data
1035857420_1035857426 21 Left 1035857420 8:2990948-2990970 CCACATTTCAATGTGATCTTTTC 0: 1
1: 0
2: 6
3: 27
4: 383
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data
1035857419_1035857426 22 Left 1035857419 8:2990947-2990969 CCCACATTTCAATGTGATCTTTT 0: 1
1: 0
2: 2
3: 57
4: 680
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data
1035857418_1035857426 27 Left 1035857418 8:2990942-2990964 CCTTTCCCACATTTCAATGTGAT 0: 1
1: 0
2: 1
3: 20
4: 271
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data
1035857422_1035857426 -2 Left 1035857422 8:2990971-2990993 CCTTCAGTTGTAGATTGCTTTCC 0: 1
1: 0
2: 0
3: 19
4: 129
Right 1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035857426 Original CRISPR CCATAGGGTATATTAGCAAT AGG Intronic
No off target data available for this crispr