ID: 1035858189

View in Genome Browser
Species Human (GRCh38)
Location 8:2999605-2999627
Sequence AGCTGATAGTAGGAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035858189_1035858200 21 Left 1035858189 8:2999605-2999627 CCTCCACCCTCCTACTATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1035858200 8:2999649-2999671 CTGTGATAAAATCAAGGAGGAGG No data
1035858189_1035858197 15 Left 1035858189 8:2999605-2999627 CCTCCACCCTCCTACTATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1035858197 8:2999643-2999665 TTTATCCTGTGATAAAATCAAGG No data
1035858189_1035858198 18 Left 1035858189 8:2999605-2999627 CCTCCACCCTCCTACTATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1035858198 8:2999646-2999668 ATCCTGTGATAAAATCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035858189 Original CRISPR AGCTGATAGTAGGAGGGTGG AGG (reversed) Intronic
900361580 1:2291628-2291650 AGGTGCTGGAAGGAGGGTGGGGG - Intronic
905295485 1:36951832-36951854 AGCAGAGAGAAGGAGGTTGGAGG + Intronic
905518635 1:38580540-38580562 AGCAGACAGGAGGAGGATGGAGG - Intergenic
905678242 1:39845568-39845590 AGGTGAGACTAGGAGGGTGCAGG + Intronic
906941935 1:50263061-50263083 AGATGATAGTAGGAGGATGTGGG + Intergenic
907046051 1:51300792-51300814 GGCTGAGAGTAGGAGAGGGGTGG - Intronic
907637668 1:56152533-56152555 AGTTGAGAGTAGGAGAATGGAGG + Intergenic
907892379 1:58648214-58648236 AGCTGGTAGAAGGTGGGTTGTGG + Intergenic
909951145 1:81721868-81721890 ACCTGATAGTAAGAAGGTGGAGG + Intronic
910050103 1:82963474-82963496 GGCTTATAGTAGGAGAGTAGAGG - Intergenic
910437560 1:87220537-87220559 AGCTGGTAGTATGAGGATGCTGG + Intergenic
910589821 1:88918704-88918726 AGCTGCCTGTAGCAGGGTGGTGG + Intergenic
911256660 1:95641008-95641030 AGTTGATAGGAGTAGAGTGGTGG - Intergenic
915649772 1:157301277-157301299 AGGTGATAGGAGGAGGCTGGTGG - Intergenic
915661669 1:157410292-157410314 AGGTGATAGGAGGAGGCTGGTGG + Intergenic
916063903 1:161120802-161120824 AGCTCATAGTGGCAGGGTGGGGG - Exonic
916108370 1:161446891-161446913 AGCCGAGAGTGCGAGGGTGGCGG + Intergenic
916109957 1:161454271-161454293 AGCCGAGAGTGCGAGGGTGGCGG + Intergenic
916111543 1:161461682-161461704 AGCCGAGAGTGCGAGGGTGGCGG + Intergenic
916113129 1:161469062-161469084 AGCCGAGAGTGCGAGGGTGGCGG + Intergenic
917243911 1:172979526-172979548 AGCTGATTGTAAGAGACTGGAGG - Intergenic
920917154 1:210267044-210267066 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
923482945 1:234401828-234401850 TGCTGATAGTGAGAGGGTTGGGG - Intronic
924048613 1:240058184-240058206 AGCTGCATGTAGGAGGGTAGAGG - Intronic
1064610560 10:17096097-17096119 AGCAGAAAGTAGAATGGTGGTGG + Intronic
1067427670 10:46221882-46221904 AGCTGATAGAAGAAGTGTGGGGG + Intergenic
1069642824 10:69967090-69967112 AGGAGATAGAAGGAGGGAGGTGG - Intergenic
1069764289 10:70841626-70841648 AGCTGATGGTAGGAGGAAGAGGG - Intronic
1070790872 10:79188619-79188641 AGGGGATACTAGGGGGGTGGGGG - Intronic
1071009093 10:80916177-80916199 AGGTGATAGTAGGAGACTGCAGG - Intergenic
1073395742 10:103215884-103215906 ACTTGATAGTAGGAAGGTAGAGG + Intergenic
1075072218 10:119326957-119326979 AGCTGATGGGAGGGTGGTGGAGG + Intronic
1076725213 10:132409894-132409916 AGCTGATGGGGTGAGGGTGGGGG + Intronic
1076978705 11:193904-193926 AGCTGCTGGTATGAGGGCGGCGG + Exonic
1077899777 11:6479032-6479054 GGCTGAGAGTAGGAGCCTGGGGG - Intronic
1078282633 11:9918296-9918318 AGCTAAAAATAGGAGGATGGGGG - Intronic
1079189009 11:18262158-18262180 ACCTGATAGTAAGAAGGTGGAGG + Intergenic
1080741075 11:35064774-35064796 AGCTGAGAGTAGGAGGGCATGGG - Intergenic
1083196601 11:61092153-61092175 AGCTGAGGGTGGGAGGGAGGAGG - Intergenic
1083397415 11:62401301-62401323 AGCTCATAGTTGGGGGCTGGGGG + Intergenic
1086914341 11:92511576-92511598 AGCTCACAGTAGGATGGTAGAGG + Intronic
1087339025 11:96878720-96878742 AGCTGTAGGTGGGAGGGTGGAGG + Intergenic
1087684168 11:101244798-101244820 AGGTGATTGGAGGATGGTGGAGG + Intergenic
1088683790 11:112268173-112268195 ACCTGATAGTAAGAAGGTGGAGG - Intronic
1088773678 11:113061088-113061110 AGCTGAGAGTAGAATGGTAGTGG - Intronic
1088783180 11:113155860-113155882 GGCTGAGAGGAGGAGAGTGGAGG - Intronic
1089286625 11:117411688-117411710 AGCTGAGAGAAAGAGGGAGGAGG + Intronic
1089534850 11:119154640-119154662 AGCTGGGAGTGGGAGAGTGGTGG + Intronic
1090247802 11:125229181-125229203 AGGTGATAGTGTGGGGGTGGTGG - Intronic
1090636162 11:128691886-128691908 AAGTGCTAGGAGGAGGGTGGGGG + Intronic
1092575975 12:9783007-9783029 TGCTTATAGGAGGAGGTTGGAGG + Intergenic
1095385735 12:41647522-41647544 GGGTGATGGTGGGAGGGTGGAGG - Intergenic
1095771060 12:45957999-45958021 AGCTGATGGGGGGAGGTTGGAGG - Intronic
1098094877 12:66944612-66944634 AGCTGATGGAAAGAGGGTAGGGG + Intergenic
1098101215 12:67018887-67018909 AGCAGAGAGGAAGAGGGTGGGGG - Intergenic
1099073489 12:78076187-78076209 AGCTGGTTTTAGGATGGTGGTGG - Intronic
1099607547 12:84824300-84824322 AGCAGAAAGTAGAATGGTGGTGG - Intergenic
1100371581 12:93973579-93973601 AGCTGGGAGTGGGAGGATGGTGG + Intergenic
1100385492 12:94101658-94101680 CGGGGAAAGTAGGAGGGTGGGGG + Intergenic
1101578070 12:106016073-106016095 ACCTGATAGTAAGAGGGTGGAGG + Intergenic
1101708656 12:107244451-107244473 AGCTGGAAGTAGGAGAGTGATGG + Intergenic
1102059244 12:109920397-109920419 TGCTTACAGTAGGAGGCTGGCGG + Intronic
1102185142 12:110941823-110941845 AGGAGAGAGTAGGAGGGGGGAGG - Intergenic
1105296989 13:19096364-19096386 TGCTGTTAGTAGGAGTCTGGGGG - Intergenic
1108537999 13:51406185-51406207 AGCTGTGAGTAGTAGGGTTGGGG - Intronic
1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG + Intergenic
1109254260 13:60059680-60059702 AGCTCAAAGTTGGGGGGTGGGGG + Intronic
1110874532 13:80491947-80491969 AGCAGAGAGTAGAATGGTGGTGG - Intergenic
1113222706 13:108123261-108123283 AGGAGATGGTAGGAGGGTGAGGG + Intergenic
1114528906 14:23382942-23382964 AGCTGAAGGCAGGAAGGTGGCGG - Intronic
1115122204 14:29951065-29951087 ACATGGTAGCAGGAGGGTGGTGG - Intronic
1116897655 14:50332879-50332901 AGCTGATTTTAGAAGGGTGAAGG - Exonic
1117687392 14:58268496-58268518 AACTGAAACTAGGAGGGCGGAGG - Intronic
1118590967 14:67400648-67400670 AGTTAATGGTAGGAGGGAGGTGG + Intronic
1121007229 14:90498215-90498237 AGGTGATATTAGGATGCTGGAGG + Intergenic
1121007234 14:90498255-90498277 AGCTGATATTAGGATGCTGGAGG + Intergenic
1121007254 14:90498389-90498411 AGCTGATATTAAGATGCTGGAGG + Intergenic
1121007276 14:90498521-90498543 AGCTGACATTAGGAAGCTGGAGG + Intergenic
1121430704 14:93885458-93885480 AACTGAGAGTGGGAGGGAGGGGG - Intergenic
1121525556 14:94616632-94616654 AGCTGAAAGTAAGGGGGTGGGGG + Intronic
1123033336 14:105461442-105461464 GGCTGACGGTTGGAGGGTGGGGG - Intronic
1125040935 15:35186567-35186589 AGCTGGTAGAAGCAGGGTGGTGG - Intergenic
1128323976 15:66711673-66711695 AGCCGAGAGTAGGGAGGTGGCGG - Exonic
1128374510 15:67065683-67065705 AGCCGGGAGGAGGAGGGTGGCGG + Intronic
1128682558 15:69662386-69662408 AGTTGGTAGTAGGAGGCTGATGG + Intergenic
1128973754 15:72132813-72132835 AAATGATAGTAGGAATGTGGAGG - Intronic
1129156209 15:73719736-73719758 AGCTGCAAGGAGGAGGGTGGGGG - Intergenic
1132660275 16:1058021-1058043 AGCTGGGAGGAGGGGGGTGGGGG + Intergenic
1134077641 16:11303238-11303260 AGGTGAAAGGCGGAGGGTGGAGG - Intronic
1135078709 16:19415769-19415791 AAATGAGAGGAGGAGGGTGGTGG - Intronic
1137872918 16:51967793-51967815 AGCTGAAAGGAGAAGGCTGGGGG - Intergenic
1141210242 16:81972896-81972918 AGCTCATTTTAGGAGGGTAGAGG + Intergenic
1141592105 16:85076284-85076306 AGTTGGTTGTTGGAGGGTGGTGG + Intronic
1142466134 17:138395-138417 AGCTGCTGGTATGAGGGCGGCGG + Exonic
1142618101 17:1148398-1148420 GTCAGAAAGTAGGAGGGTGGTGG + Intronic
1142692963 17:1617867-1617889 AGCTGAAGATGGGAGGGTGGAGG + Intronic
1143010347 17:3862580-3862602 GGCTGATAGTTGGAGGATGTAGG - Intronic
1143720760 17:8807480-8807502 AGGTGAGGGGAGGAGGGTGGAGG + Intronic
1143766719 17:9142553-9142575 AGATGATGGGAGGGGGGTGGAGG + Intronic
1143860384 17:9886242-9886264 CACTGATAGCAGGAGGCTGGTGG - Intronic
1146234492 17:31145638-31145660 TGCTGTTAGTAGGAGCCTGGGGG + Intronic
1146605867 17:34257239-34257261 AGCTGAGAGTATGAGCTTGGTGG + Intergenic
1146932891 17:36790682-36790704 AGCTGACTGAATGAGGGTGGAGG - Intergenic
1148222100 17:45870224-45870246 AGATGATAGGAGGAGGCAGGGGG + Intergenic
1149389628 17:56175915-56175937 ATAAGATAGTAGGGGGGTGGGGG + Intronic
1150708138 17:67507002-67507024 AGTTGATAGTATGGTGGTGGTGG + Intronic
1153179393 18:2415992-2416014 ATTTGATAGCAGGAGGCTGGGGG - Intergenic
1155247169 18:23921769-23921791 AGTGGAAAGAAGGAGGGTGGGGG + Intronic
1155382521 18:25239770-25239792 AGCTGGAAATAGGAGGGGGGAGG + Intronic
1160283946 18:77521566-77521588 CGCTGATTGTTGGAGGGTGGAGG - Intergenic
1161698321 19:5782470-5782492 ACCTGATGGTCTGAGGGTGGGGG - Intergenic
1163684722 19:18704921-18704943 GGAGGGTAGTAGGAGGGTGGGGG - Intronic
1164398343 19:27885692-27885714 AGGTTATATTAGGAGGCTGGAGG - Intergenic
1165579426 19:36849712-36849734 AGCTGATACTATGACTGTGGAGG - Intronic
1165810278 19:38607799-38607821 AGGGGATTGTAGGAAGGTGGGGG + Intronic
1166382785 19:42363352-42363374 AGATGGAAGGAGGAGGGTGGAGG - Intronic
1166774355 19:45303295-45303317 GGCTGACAGGAGGAGGGTCGGGG - Exonic
1167699557 19:51034495-51034517 AGCTGAGATGGGGAGGGTGGTGG + Intronic
925163178 2:1701082-1701104 TGCTGAAAGTGGGAGGCTGGGGG + Intronic
925619252 2:5774730-5774752 GGCTGCTAGCAGGAGGGTGAGGG - Intergenic
926266883 2:11331008-11331030 AGCAGAAAGAAGGAGGGAGGAGG + Intronic
926354094 2:12023735-12023757 ACCTAATAGTAAGAAGGTGGAGG + Intergenic
926965427 2:18404723-18404745 AGGTGATAGTGGGAGGGAAGTGG + Intergenic
926974266 2:18497490-18497512 TGCAGAGAGTTGGAGGGTGGAGG - Intergenic
927422677 2:22949427-22949449 AGCAGAAGTTAGGAGGGTGGGGG + Intergenic
927492748 2:23531407-23531429 ATCTGGTAGTGGGTGGGTGGGGG - Intronic
929581219 2:43082767-43082789 AGCTCAGGGGAGGAGGGTGGAGG + Intergenic
930749741 2:54922857-54922879 AGTAGAGAGTAGAAGGGTGGTGG + Intronic
932279166 2:70474630-70474652 AGCTGCTGGAAGTAGGGTGGTGG + Intronic
932509871 2:72275608-72275630 TGCTGATTGTAAGAGGGTTGAGG - Intronic
932598840 2:73110847-73110869 AGCTGATTGGTGGAGGGTGAAGG + Intronic
932815732 2:74860165-74860187 GGGTGAGGGTAGGAGGGTGGGGG + Intronic
932854910 2:75222933-75222955 AGCTGTTATTAGGATGGGGGCGG + Intergenic
934792077 2:97069998-97070020 AGCTGAAAGAAGGAGGGAAGAGG - Intergenic
934814542 2:97313712-97313734 AGCTGAAAGAAGGAGGGAAGAGG + Intergenic
934823151 2:97394771-97394793 AGCTGAAAGAAGGAGGGAAGAGG - Intergenic
935303899 2:101718547-101718569 GGCTGACAGTGGGAAGGTGGGGG + Intronic
937209958 2:120262144-120262166 AGCTGATAGTAACAAGGTGAAGG + Intronic
937335714 2:121061140-121061162 TGCTGATTGTAGGGGGCTGGGGG + Intergenic
938309474 2:130278621-130278643 AGCAGATACTAGTAGGGTGATGG - Intergenic
938609779 2:132935613-132935635 AGCTGACAGTAGGTTGGGGGTGG + Intronic
942045507 2:172097173-172097195 AGCCGAGAGCAGGAGGGTGAAGG - Intergenic
945700912 2:213170015-213170037 ATCACATATTAGGAGGGTGGGGG + Intergenic
946372525 2:219289721-219289743 AGCGCATGGTGGGAGGGTGGTGG + Exonic
947074854 2:226331520-226331542 AGCAGTAAGTAGAAGGGTGGGGG + Intergenic
948547770 2:238745138-238745160 AGCCCAAAGTGGGAGGGTGGCGG - Intergenic
1168805528 20:670307-670329 AGCAGAAAGTAGGAGGCCGGGGG - Intronic
1168908926 20:1429503-1429525 ACCTGATAGTCTTAGGGTGGAGG - Intergenic
1169755179 20:9035814-9035836 ATCAGATAGTAGGAATGTGGTGG + Intergenic
1170073943 20:12398525-12398547 GGAGGATAGTAGGATGGTGGGGG + Intergenic
1171346813 20:24471285-24471307 AGCTGCTAGGAGGCGGGCGGGGG + Intronic
1173724376 20:45287092-45287114 AGCTGATGGTGGAGGGGTGGTGG - Intergenic
1173817520 20:45999204-45999226 AGCTGATAAAAGGAGGTAGGAGG + Intergenic
1173949537 20:46979247-46979269 AGATGACAGCTGGAGGGTGGGGG - Intronic
1174253619 20:49237767-49237789 AGCTGAGAGAACAAGGGTGGAGG + Intronic
1174784395 20:53418966-53418988 AGCTGAGTGGAGGAGGCTGGAGG - Intronic
1176932179 21:14826700-14826722 AGCACATGGTAGGAAGGTGGAGG - Intergenic
1177262427 21:18748523-18748545 AGCTGTGCCTAGGAGGGTGGGGG + Intergenic
1177649515 21:23942277-23942299 TGCTCATGGTGGGAGGGTGGGGG - Intergenic
1179244924 21:39624632-39624654 TGCTGATGGAAGGATGGTGGTGG + Intronic
1182011757 22:27006849-27006871 ATCAGATAGTAGAAGGGCGGGGG + Intergenic
1182051804 22:27317961-27317983 AGTGGAAAGCAGGAGGGTGGAGG - Intergenic
1182114142 22:27745360-27745382 AGCTTGGATTAGGAGGGTGGTGG - Intergenic
1183112122 22:35658140-35658162 AGAAGTGAGTAGGAGGGTGGAGG - Intronic
1183604632 22:38861210-38861232 AGGTGAGAGTGGGAGGATGGAGG - Intergenic
1183882674 22:40848339-40848361 ACCTGATAGTAAGAAGGTGGAGG - Exonic
1184001163 22:41674667-41674689 AGCAGACAGAAGCAGGGTGGTGG - Exonic
1185269175 22:49920816-49920838 GGCTGATGGTGGGCGGGTGGGGG - Intronic
950547198 3:13645586-13645608 AGCTGTGAGTTGGAGGTTGGTGG + Intergenic
954069914 3:48135412-48135434 AGCTGCTGGTGGGAGGCTGGGGG - Intergenic
954581035 3:51703065-51703087 AGCTGCAAGGAGGAGGGTGCTGG - Intronic
954817187 3:53292048-53292070 AGGTAATGGCAGGAGGGTGGGGG - Exonic
955816160 3:62845695-62845717 AGATGATAGTGGGAGGTGGGAGG - Intronic
957302151 3:78405876-78405898 AGCTGAAAGAAGGAGGAGGGAGG - Intergenic
958042209 3:88240446-88240468 AGCTGAGAATAGGAAGGTCGAGG - Intergenic
959560867 3:107779197-107779219 AGGGGATTGTAAGAGGGTGGGGG + Intronic
961562207 3:127738448-127738470 AGCTGCTGGTGGAAGGGTGGAGG + Intronic
962135709 3:132729870-132729892 AGCAGAGAGTAGAATGGTGGTGG - Intergenic
963293430 3:143518031-143518053 ACCTGACAGTAAGAAGGTGGAGG - Intronic
963732863 3:148989619-148989641 AGCTGATGGCAGGAGGGTTCTGG + Intergenic
963774954 3:149429245-149429267 AGCTGTGAGTAAGAGAGTGGAGG + Intergenic
963907345 3:150783464-150783486 TGCAGAGAGTAGGAGGGTGCTGG + Intergenic
965614994 3:170585070-170585092 AGGAGAGAGAAGGAGGGTGGGGG + Intronic
967315629 3:188149880-188149902 AACTACTAGAAGGAGGGTGGAGG + Intergenic
967855854 3:194117010-194117032 AGCAGTTAGTGCGAGGGTGGTGG - Intergenic
969323349 4:6426290-6426312 AGCTGATCGTAGAAGGGAGCTGG - Intronic
969925337 4:10579940-10579962 TGCTTATAGGAGGAGGCTGGAGG - Intronic
970325637 4:14920561-14920583 AGCTGGTAGAAGGAAGGTGCTGG + Intergenic
971774291 4:30941536-30941558 AGTTGATAGTAAGAGGAGGGAGG + Intronic
972987367 4:44780767-44780789 AGCTACTAGCAGGGGGGTGGGGG - Intergenic
973916053 4:55635990-55636012 AGGTGAGAGAAAGAGGGTGGAGG + Intronic
974399729 4:61388077-61388099 AGCTGATAGTGGGAGAGGGGTGG - Intronic
976911585 4:90313605-90313627 TGCTTTTAGTATGAGGGTGGAGG + Intronic
978172880 4:105695039-105695061 AGCTGTTTGTGGGCGGGTGGGGG - Intronic
979671631 4:123365885-123365907 AGCTGTTAGTAGGAGGAAGAAGG + Intergenic
981335284 4:143562430-143562452 AGCATTTTGTAGGAGGGTGGGGG + Intergenic
981398332 4:144281124-144281146 AGGAGATAGCAGGAGTGTGGTGG - Intergenic
983196004 4:164807242-164807264 GGCTGCTAGTAGGGAGGTGGGGG + Intergenic
983930793 4:173450959-173450981 ACCTGAAAGTAGGAAGGGGGAGG + Intergenic
985324117 4:188748407-188748429 AGATGATACTAGGTGGGTGGCGG + Intergenic
986870764 5:12043069-12043091 AGCTGGTACTAGGCAGGTGGTGG - Intergenic
987017510 5:13835687-13835709 AGGTTATATTAGGAGGCTGGAGG - Intronic
987325837 5:16811150-16811172 AGCTGATGGTAAGTGGGGGGGGG + Intronic
991019134 5:61961889-61961911 AGATGTTATTAGGAGGATGGAGG - Intergenic
991975601 5:72181203-72181225 TACTGAAAGTAGGATGGTGGGGG + Intronic
993054766 5:82969069-82969091 AACTGATAGTAAGAAGGTGGAGG + Intergenic
994077236 5:95667306-95667328 AGCTAAGAGTGGGGGGGTGGGGG + Intronic
996542050 5:124640619-124640641 ATCTCATAGTAGGTGGGTGGTGG - Intronic
996810108 5:127506950-127506972 AGGTGGGAGCAGGAGGGTGGAGG + Intergenic
998569876 5:143247527-143247549 GATTGATAGTAGGTGGGTGGTGG + Intergenic
999630454 5:153565599-153565621 ACCTGATGGTGGGAGGGTGCTGG - Intronic
1004521193 6:16362454-16362476 TGCTGAGAGCGGGAGGGTGGGGG - Intronic
1004902291 6:20205761-20205783 TGCTGTTAGCAGGTGGGTGGGGG - Intronic
1006045022 6:31287886-31287908 AGCTGATATGAGGAAGGAGGCGG + Intronic
1006096135 6:31657985-31658007 AGTTGATAGTAATGGGGTGGGGG - Intronic
1006668297 6:35713604-35713626 AGCTGCTAGCTGGCGGGTGGGGG + Intronic
1008379903 6:50829741-50829763 ATGGGATAGTAGGAGGGTTGTGG + Intronic
1008758604 6:54827362-54827384 AGTTGAGAGTGGGAGGATGGAGG + Intergenic
1009355705 6:62740898-62740920 AGCTGGTAGAAGTAGGATGGTGG - Intergenic
1010898398 6:81394436-81394458 AGTTCATAGCAGAAGGGTGGGGG - Intergenic
1011395017 6:86897294-86897316 ACCTGACAGTAAGAAGGTGGAGG + Intergenic
1012603549 6:101129228-101129250 AGTTGATAATAAGAGTGTGGAGG + Intergenic
1015382452 6:132585353-132585375 AGCTGATGGTTGGAGAGGGGAGG - Intergenic
1015707336 6:136102260-136102282 AGCTGGTAGGGGGTGGGTGGGGG + Intronic
1016038051 6:139403409-139403431 AGCTGAGAGTGAGGGGGTGGTGG + Intergenic
1017006768 6:150033063-150033085 AGCAGACAGTAGTAGGTTGGAGG + Intergenic
1021402388 7:20224205-20224227 AGCAGAGAGCAGCAGGGTGGAGG + Intergenic
1022389810 7:29933711-29933733 AGCACATAGTAGGAGGAGGGAGG + Intronic
1022888611 7:34673236-34673258 AGCTTATAGTCTGATGGTGGAGG - Intronic
1022968391 7:35495231-35495253 TGCAGAAAGTAGGATGGTGGTGG - Intergenic
1026090227 7:67293430-67293452 AGGTGTTGGCAGGAGGGTGGGGG + Intergenic
1027119821 7:75508745-75508767 AGGTGTTGGCAGGAGGGTGGGGG + Intergenic
1027272007 7:76526862-76526884 AGGTGTTGGCAGGAGGGTGGGGG - Intergenic
1028841409 7:95433653-95433675 AGATGAGAATAGTAGGGTGGTGG - Intronic
1032588455 7:133170317-133170339 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
1033217330 7:139502630-139502652 ACCTGATAGTAAGAAGGTGAAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034263744 7:149772091-149772113 AGCTGAGAGGAGGAGGGCGGGGG - Intronic
1035577333 8:716217-716239 AGCTGATGGCAGGATGGTGGGGG - Intronic
1035858189 8:2999605-2999627 AGCTGATAGTAGGAGGGTGGAGG - Intronic
1042689584 8:71483255-71483277 AGCTGAGAGAGGGAGGTTGGTGG - Intronic
1043456151 8:80414352-80414374 AGCTGAGAGGAGGAGGGGGCTGG + Intergenic
1044478280 8:92654234-92654256 AGATGATAGTAGTAGAGAGGGGG + Intergenic
1045544428 8:103115656-103115678 AGCAGAGAATAGGAGGGTGTTGG - Intergenic
1047362662 8:124183468-124183490 AGCCCATAGAAGGGGGGTGGTGG - Intergenic
1048216789 8:132502904-132502926 AGGTGACAATAGGAGGGTGCTGG + Intergenic
1048322142 8:133408182-133408204 ACCTGATAGTAAGAAGGTGGAGG + Intergenic
1048937776 8:139371160-139371182 AGCTAATATTAGGAGGTGGGGGG - Intergenic
1049518946 8:143078510-143078532 AGGTGGTAGTTGGAGGTTGGAGG - Intergenic
1049672225 8:143875042-143875064 AGCTGAGGGTAGGTGGGAGGAGG - Intronic
1054834854 9:69666388-69666410 TGATGATAGTGGGTGGGTGGGGG - Intronic
1054906906 9:70420251-70420273 AGCGGAGAGGAGGAGGGAGGCGG - Intergenic
1054985004 9:71251844-71251866 AGAGGATGGTGGGAGGGTGGGGG - Intronic
1055489358 9:76789054-76789076 ATCTGAAAATATGAGGGTGGAGG - Intronic
1059009062 9:110437071-110437093 AGCTGAGTGGAGAAGGGTGGAGG - Intronic
1059325748 9:113503233-113503255 GGCTGAGAGCCGGAGGGTGGAGG + Intronic
1059418488 9:114176523-114176545 CCCAGATAGTAGGTGGGTGGGGG + Intronic
1060286760 9:122260438-122260460 ATTTGATAGAGGGAGGGTGGTGG - Intronic
1060523413 9:124307470-124307492 ATTTGAGAGGAGGAGGGTGGAGG - Intronic
1060963771 9:127700210-127700232 AGCTGAGAGAAGGAGGGAGCGGG - Intronic
1061053387 9:128209017-128209039 AGGTGAGACTAGGAGGGTTGGGG + Intronic
1186334020 X:8567036-8567058 AAATGAGAGTAGGAGGGAGGAGG - Intronic
1186489351 X:9959482-9959504 AGATGATAGAAGGAGGGTCAGGG - Intergenic
1187945601 X:24423698-24423720 AGCTGAAAGTAGGAGGGTCAAGG - Intergenic
1188324788 X:28787957-28787979 AGCAGAGAGTAGAATGGTGGTGG + Intronic
1190546104 X:51529274-51529296 AGCAGATAGTAGAATGGTAGTGG + Intergenic
1190773491 X:53534236-53534258 AGCTCCTAGAAGCAGGGTGGGGG + Intronic
1193584627 X:83305880-83305902 AGCTGATGGAAGGATGGGGGAGG + Intergenic
1193941158 X:87682178-87682200 AGCAGAGAGCAGGAGGATGGGGG - Intergenic
1194388623 X:93288644-93288666 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
1196192730 X:112811418-112811440 TGGTGATGGTAGGAGGGTGATGG + Intronic
1198815633 X:140587142-140587164 AGCAGAGCGCAGGAGGGTGGAGG + Intergenic
1199600851 X:149540341-149540363 CGCTGAGAGAAGGAGGGAGGGGG - Intronic
1199973255 X:152876100-152876122 AGATGATAGGAGCAGGGTTGTGG + Intergenic
1200070417 X:153526305-153526327 AGCTGGTGGTGGGAGGGTAGGGG + Intronic