ID: 1035860010

View in Genome Browser
Species Human (GRCh38)
Location 8:3018361-3018383
Sequence TCCACCCCAGGTAGGATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035860004_1035860010 22 Left 1035860004 8:3018316-3018338 CCTGTAGATACTCAAAGAAAAAA 0: 1
1: 0
2: 4
3: 46
4: 720
Right 1035860010 8:3018361-3018383 TCCACCCCAGGTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1035860003_1035860010 23 Left 1035860003 8:3018315-3018337 CCCTGTAGATACTCAAAGAAAAA 0: 1
1: 0
2: 2
3: 41
4: 644
Right 1035860010 8:3018361-3018383 TCCACCCCAGGTAGGATTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035860010 Original CRISPR TCCACCCCAGGTAGGATTTA AGG Intronic
903032440 1:20473523-20473545 TCCACCTCAGCTAGGATTGCAGG + Intergenic
903483349 1:23670634-23670656 TCCACCACAGGTGGGGATTATGG + Intergenic
903691721 1:25178819-25178841 TCCAACCCAGGAAGGAGTGAGGG + Intergenic
907105360 1:51878139-51878161 TCCACCCAAGGAAGCATTTGGGG + Intronic
907707943 1:56848756-56848778 TCCACCACATGTGGGAATTATGG + Intergenic
912216731 1:107622528-107622550 TCCAATCCAGGTAGTATTAAGGG - Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
919866460 1:201786717-201786739 TCCACCCAAAGTAAGATTGAAGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920586555 1:207169441-207169463 TCCACCACACGTGGGAATTACGG - Intergenic
1064251983 10:13712962-13712984 TCCTCCCCAGCCAGCATTTATGG + Intronic
1068473529 10:57495679-57495701 TCCACCACATGTGGGAATTATGG + Intergenic
1069312703 10:67058398-67058420 TCCACCACAGGTACAATTTCTGG + Intronic
1072220845 10:93326364-93326386 TCCTACCCAGGAGGGATTTATGG - Intronic
1084006233 11:66325036-66325058 TCTACCCCAGGCAGGAGTTGGGG + Intergenic
1087211801 11:95452728-95452750 TCAACCCAGGGTAGGATCTATGG + Intergenic
1087586411 11:100127566-100127588 TTGACTCCAGGTAGGATTTCAGG - Intronic
1087895265 11:103579272-103579294 TCCACACCACATAGGATTTAGGG + Intergenic
1090042522 11:123303153-123303175 TTCAGCACAGGTAGGATCTAGGG + Intergenic
1093581210 12:20785834-20785856 TCCACAGCATGTAGGAATTATGG - Intergenic
1096610837 12:52800446-52800468 TCCTCCCCAGGCAGGATTGATGG - Intergenic
1101432966 12:104641925-104641947 TCCACCCCAGGGAGGACATTTGG + Intronic
1105506487 13:21014535-21014557 TACACACCAGGAAGGTTTTATGG + Intronic
1110815403 13:79855219-79855241 ACCACCCCAGGTAGTCTTCATGG + Intergenic
1119866649 14:77980319-77980341 TCCTCCCCAGGTTGGACTGATGG - Intergenic
1120056126 14:79926303-79926325 CCCACAACAGGTGGGATTTAGGG - Intergenic
1121328424 14:93034934-93034956 CCCACCCCAGGTAGCACTGACGG + Intronic
1126372528 15:47962375-47962397 TACACCCCAGGAAGGATCTTAGG + Intergenic
1127457765 15:59170613-59170635 CCCACCTCAGGTAGGTTTCAAGG - Intronic
1137981447 16:53073577-53073599 CCCACCACAGGTGGGAATTATGG - Intronic
1138845203 16:60556617-60556639 AACACCACAGGTAGGATTTTAGG + Intergenic
1141788049 16:86214810-86214832 TCCACCCCAGGGAGGGGTTGTGG + Intergenic
1141819738 16:86437058-86437080 TCCACCCCAGCTTGGCTTTGTGG + Intergenic
1148122814 17:45222485-45222507 TCCACCCCAGCTGGGTCTTAAGG + Intronic
1150206374 17:63411736-63411758 TCAACCCCAGGTAGTATGGATGG - Intronic
1153505245 18:5790098-5790120 TCCACCCGAAGTAGTATTTGAGG - Intergenic
1153594258 18:6708449-6708471 TCCACCCCAGGTGTGTTTCAGGG + Intergenic
1158545074 18:58389225-58389247 TCCACCTGAGGCAGGATTGAGGG + Intronic
1160834365 19:1117594-1117616 CCCACGCCAGGTGGAATTTAGGG + Intronic
1161282840 19:3454928-3454950 TCCAGCCCAGGGTGGATTTGGGG - Intronic
1162599841 19:11659768-11659790 TCCAGCCCAGGTAGAATTAAAGG - Intergenic
1163391117 19:17030513-17030535 TCACCCCCAGGTAGGATCTCTGG - Intergenic
1163572973 19:18093706-18093728 TCCACCCCAGGCTGGACTAAGGG + Intronic
1165325817 19:35114132-35114154 TCCAGCCTAGGAAGAATTTATGG + Intergenic
1166637756 19:44466361-44466383 ACCACCCCAAGTAGGCTTCAGGG + Intergenic
926034091 2:9620978-9621000 TCCACCCCACAAAGGATATAGGG - Intronic
927514879 2:23666370-23666392 TCCACCCCAGGCAGCAACTAGGG + Intronic
929412221 2:41709841-41709863 TCCACTGCAGCTAGGTTTTAAGG - Intergenic
929959656 2:46486995-46487017 TCCTCCCAAGGTAGGATCTTGGG - Intergenic
931120842 2:59217745-59217767 TCAACCCCAGGGAGGATTTCTGG + Intergenic
936400818 2:112163190-112163212 TCCGGCCCAGGTGGGATTTTGGG + Intronic
943342295 2:186694969-186694991 TTTACCCCAGGAAGGGTTTAAGG + Intronic
946026487 2:216674779-216674801 TCCACCCCAGGGAGGATGCAGGG + Exonic
1168792335 20:587214-587236 TCCACCCCAGTTAGAACATAAGG - Intergenic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1174457448 20:50659742-50659764 TCCAGGCCAGGGAGGAGTTATGG + Intronic
1181013387 22:20055013-20055035 CCCACCCCTGGTAGGCTTCAAGG - Intronic
1181333136 22:22110029-22110051 GCCACCCCAGGAAGGTTGTATGG + Intergenic
1181794069 22:25291123-25291145 CCCACCACAGGTGGGAATTATGG - Intergenic
1181834068 22:25587673-25587695 CCCACCACAGGTGGGAATTATGG - Intronic
1183366057 22:37407563-37407585 GCCACCACAGGTAGGGCTTATGG + Intronic
1185164955 22:49255724-49255746 TGCACCCCCGGGAGGATTCACGG + Intergenic
1185240334 22:49739447-49739469 TCCACAACACGTAGGAATTATGG - Intergenic
1185302065 22:50087025-50087047 TCCACGACATGTAGGAATTATGG - Intergenic
956791679 3:72684882-72684904 TTCAGCCTAGGTTGGATTTAGGG - Intergenic
957292179 3:78292179-78292201 CCCACAACATGTAGGATTTATGG + Intergenic
959453421 3:106531183-106531205 TCCACAACATGTAGGAATTATGG - Intergenic
969864009 4:10061369-10061391 TCCACCCCAGATGGGAAATAGGG + Intergenic
969980698 4:11151130-11151152 TCCACAACACGTGGGATTTATGG + Intergenic
973557424 4:52098613-52098635 TCCACCTCATGAAGGATTTGTGG - Intergenic
975232760 4:71954198-71954220 TCCACCCCAGATGGGCTTGATGG + Intergenic
977459038 4:97300692-97300714 TCCAGCCCAGATAGGATCTGGGG - Intronic
979135915 4:117113287-117113309 CCCACAACAGGTAGGAATTACGG + Intergenic
979363458 4:119792240-119792262 CCCACCCCAGGTGGTTTTTATGG - Intergenic
984974172 4:185215748-185215770 TATACCACAGATAGGATTTAAGG - Intronic
989523536 5:42427487-42427509 TCCACCACATGTGGGAATTATGG + Intronic
990077696 5:51871998-51872020 TCCACAACATGTAGGAATTATGG - Intergenic
991183962 5:63786099-63786121 TCCACAACACGTAGGAATTATGG - Intergenic
992769814 5:80036003-80036025 TCCGCCTGAGGAAGGATTTAGGG - Intronic
995383500 5:111563221-111563243 TCCACCCCAGGTAACATCTGAGG + Intergenic
995703724 5:114963140-114963162 TCCACAGCACGTAGGAATTATGG + Intergenic
1005036030 6:21555632-21555654 TGCAACCCAGGGAAGATTTAAGG + Intergenic
1005417199 6:25612615-25612637 CCCACCCCACTTAGGATTCAAGG - Intronic
1006019659 6:31110618-31110640 GCCACCCCAGGTGGGATTGTTGG + Intergenic
1007531632 6:42547876-42547898 TCCCCCCCAGGCAGGGTATAAGG - Intergenic
1010205434 6:73318648-73318670 CCCACCACACGTAGGAATTATGG + Intergenic
1012173744 6:96052262-96052284 TCCACAACAGGTAGGGATTATGG + Intronic
1013557870 6:111275163-111275185 TCCACCTCAGCTAGGATTACAGG + Intergenic
1015791458 6:136968274-136968296 TCCAGCCCCGGAAGGACTTAGGG - Intergenic
1016529580 6:145042765-145042787 GCCACCCCAGGAAGGTTGTATGG + Intergenic
1018382981 6:163276497-163276519 TCAACACCAGGTAGGAATGAAGG - Intronic
1018384882 6:163293241-163293263 TCCCTGCCAGGAAGGATTTAAGG - Intronic
1022689225 7:32629899-32629921 TTTACCCAAGGTAGGTTTTACGG + Intergenic
1023527438 7:41119246-41119268 TCCACAACATGTAGGAATTACGG + Intergenic
1024966292 7:55024898-55024920 TCCTCCCCATGTAGAATTAAAGG - Intronic
1028753064 7:94404415-94404437 TCCTCCCAAGGAAGAATTTAAGG - Intronic
1032594620 7:133226949-133226971 TCCACCACACGTGGGAATTATGG + Intergenic
1035860010 8:3018361-3018383 TCCACCCCAGGTAGGATTTAAGG + Intronic
1050308992 9:4333920-4333942 ACCATTCCAGGTAGGATTTAAGG - Intronic
1051560488 9:18435905-18435927 CCCACCACAGGTGGGAATTATGG + Intergenic
1052180393 9:25519157-25519179 TGAACCCAAGGGAGGATTTATGG + Intergenic
1055719471 9:79155595-79155617 TCCACTCCAGGTATGATAAAAGG - Intergenic
1056780026 9:89542231-89542253 TTCATTCCAGGAAGGATTTAAGG + Intergenic
1196692582 X:118576362-118576384 TCCAGCCCACGTGGGATTTCTGG + Intronic
1197285820 X:124593653-124593675 TCCACCCCAGGCAGAAATTCAGG - Intronic
1198608561 X:138371992-138372014 TCCACAACATGTAGGAATTATGG - Intergenic
1202194954 Y:22290934-22290956 CCCACCCCAGGCAGCATCTAGGG + Intergenic