ID: 1035868025

View in Genome Browser
Species Human (GRCh38)
Location 8:3106000-3106022
Sequence TAGTCCTAGAAAATAAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035868025 Original CRISPR TAGTCCTAGAAAATAAACCA AGG (reversed) Intronic
901028688 1:6293333-6293355 GAGTCCTAGAAAAAATAGCATGG + Intronic
901412634 1:9095126-9095148 TAGTCCTCCAAAATAGACAAGGG + Intergenic
902417933 1:16253013-16253035 TACTCCTAGAAAAGAAGACAGGG + Intronic
906345762 1:45013370-45013392 TGATCCTAGAATATAATCCAAGG + Intronic
907440871 1:54477299-54477321 GAGGCTTAGGAAATAAACCATGG - Intergenic
909888167 1:80968817-80968839 TAATCCTAGAAAAATAACAAAGG + Intergenic
911716389 1:101138480-101138502 TAGTTATAAAAAATAAGCCAAGG - Intergenic
912098752 1:106179708-106179730 AAGTACTAGAAAATATGCCAAGG + Intergenic
912106794 1:106288001-106288023 TAGTCCAAGATCATAAAACATGG - Intergenic
912783589 1:112576701-112576723 TAGTTGTAGAAAATAAATAATGG - Intronic
913982209 1:143531006-143531028 TAGTACCAGAAAAGAACCCATGG - Intergenic
918409410 1:184243247-184243269 AAGTCCTAGAAATGAGACCAAGG + Intergenic
918443842 1:184596500-184596522 TTGCCCTAGAAAATATTCCAGGG - Intronic
920837389 1:209524101-209524123 TAGTTTTAAAAAATAACCCAGGG - Intergenic
921335211 1:214078809-214078831 TGTTCTTAGAAAATAAACAACGG + Intergenic
922534043 1:226366773-226366795 TTGTCCTAGGAAAGAAGCCAAGG + Intronic
1063205724 10:3829189-3829211 TATTACTAGAAACTAAACTAAGG - Intergenic
1063573401 10:7238124-7238146 TCGTGTTAGAACATAAACCATGG - Intronic
1063877180 10:10492513-10492535 TCTTCCAAAAAAATAAACCATGG + Intergenic
1063894369 10:10664012-10664034 TAGTTTAAGAATATAAACCACGG + Intergenic
1065446843 10:25811048-25811070 TACTCCTGGAATATAAATCATGG - Intergenic
1066337865 10:34498334-34498356 TAAATCTAGAAAATAATCCACGG + Intronic
1066951723 10:42125347-42125369 TAGTACCAGAAAAGAACCCATGG + Intergenic
1067020829 10:42795920-42795942 TAGTGATGGAAAATAACCCATGG - Intronic
1067507739 10:46871074-46871096 CAGATCTAGAAAGTAAACCAAGG - Intergenic
1067654514 10:48180771-48180793 CAGATCTAGAAAGTAAACCAAGG + Intronic
1068467640 10:57415859-57415881 TAGACCCAGAAAATTAACTATGG + Intergenic
1068585832 10:58797256-58797278 TACTCCTAGAAAATCATCCTGGG + Intronic
1069720471 10:70546407-70546429 TAATTCTACAAAAAAAACCATGG - Intronic
1072877284 10:99186039-99186061 TAGTGACAGACAATAAACCATGG + Intronic
1073712786 10:106064129-106064151 TTGTCTTAGAAACCAAACCACGG + Intergenic
1074021146 10:109585082-109585104 TAGTGATAGAAAACAAAGCAGGG + Intergenic
1074995301 10:118752466-118752488 TAGTCCTAGAGATGAAAGCATGG - Intronic
1079526184 11:21391391-21391413 AAGTCCCAGAAATGAAACCAGGG - Intronic
1080316368 11:30954653-30954675 TGGTCCTAGAAATGAAACGATGG + Intronic
1080626115 11:34032215-34032237 TAGTCCCAGATAATATACCATGG - Intergenic
1081928421 11:46849967-46849989 TAGGCCTAGAAAATACACGATGG + Intergenic
1082913836 11:58409088-58409110 TAGTTCTAGATAATGAACTATGG + Intergenic
1084290044 11:68158204-68158226 TAATCCTAGAAAATAACTCTGGG - Exonic
1086056922 11:82657774-82657796 AAGTCCTAGAAAATAACACTAGG + Intergenic
1086645808 11:89218919-89218941 TAGTACTAGAATTTAAACCCAGG - Intronic
1086821373 11:91440475-91440497 TAGTCCTAGAAAATTAGCCTTGG + Intergenic
1086872205 11:92051577-92051599 AAAACCTAGAATATAAACCATGG - Intergenic
1087040343 11:93793086-93793108 TACTCCTAGAAATGAAACCTTGG - Intronic
1087734454 11:101816193-101816215 TATTCCTATAAAATAAGCCTTGG - Intronic
1089019768 11:115200994-115201016 GAGTACTAGAAAATAAATGAAGG + Intronic
1093769837 12:23005541-23005563 TAGTCCTAGAATATTTACCCGGG + Intergenic
1093779077 12:23113086-23113108 TAGTCCTACATTCTAAACCAAGG - Intergenic
1098251196 12:68571012-68571034 GAGTCATAGAAAAATAACCATGG - Intergenic
1098308455 12:69124585-69124607 TGGTTCTTGGAAATAAACCAAGG + Intergenic
1098556395 12:71823610-71823632 TAGTTCTAAAAAAAAAACTAAGG + Intergenic
1099363337 12:81735140-81735162 TACTCCTAGAAATCTAACCAAGG - Intronic
1100447285 12:94672886-94672908 GAATACTAGAAAATAAACCTAGG - Intergenic
1100844992 12:98649077-98649099 TAGAACTGGAAAATAAACAAGGG - Intronic
1103423880 12:120814057-120814079 TACTCTAAGAAAATAAAACATGG + Intronic
1105233570 13:18523704-18523726 TAGTACCAGAAAAGAAACTATGG - Intergenic
1107387816 13:39931506-39931528 TTGTCCTGAAAAATTAACCATGG - Intergenic
1107586119 13:41850135-41850157 TAGTCCAAGAAAGAAAACAAAGG - Intronic
1108170234 13:47734313-47734335 TGGAACTAGAAAAAAAACCAAGG - Intergenic
1110528530 13:76569084-76569106 TTGTCCTAGAAAATAAGAGAAGG + Intergenic
1111655916 13:91152951-91152973 CATTCCTAGAAAACAGACCAAGG + Intergenic
1112561422 13:100518089-100518111 TTTTCCTTGAAAATACACCAAGG - Intronic
1116201768 14:41806561-41806583 TACTTCTAAATAATAAACCAGGG + Intronic
1116421539 14:44738482-44738504 AAATCCTAGAAAATCATCCAAGG - Intergenic
1116501620 14:45630958-45630980 TTGTCCAATAAAATAAACCAGGG + Intergenic
1116678490 14:47936726-47936748 CATTTCTAGAAAATGAACCAGGG + Intergenic
1116894675 14:50304447-50304469 AACTCCGAGAAAATAAACCTTGG + Intronic
1118141404 14:63087327-63087349 TAGTGTTAGAAAATAAACGGAGG + Intronic
1118807596 14:69251379-69251401 TAGTAGTAGAAAACAAACAAAGG + Intergenic
1121373042 14:93378063-93378085 TAGGGATAGAAAATAAGCCACGG + Intronic
1121373267 14:93380521-93380543 TACTCATAGAAAATAAAAGAAGG - Intronic
1202937758 14_KI270725v1_random:107965-107987 TAGTACCAGAAAAGAACCCATGG + Intergenic
1123395453 15:19929922-19929944 TAGTACCAGAAAAGAACCCATGG - Intergenic
1125351528 15:38772351-38772373 AAGTCCAAGGAAAGAAACCAGGG - Intergenic
1125683658 15:41549253-41549275 TGATCCTAGAAAAGAAACAATGG - Intergenic
1125835623 15:42748159-42748181 TAGTTACAGAAAATAACCCAGGG + Intronic
1126911842 15:53425822-53425844 TAGTCTTAGAAAATACAACAGGG - Intergenic
1128214623 15:65925678-65925700 GAGTCCTGAAAAATAAAGCAAGG - Intronic
1129102352 15:73277767-73277789 TTCTCCTAGAAAAGCAACCAAGG - Intronic
1131802114 15:96081744-96081766 TAGTCCTAGAACATATCCTAAGG - Intergenic
1136935918 16:34464699-34464721 TAGTACCAGAAAAGAACCCATGG + Intergenic
1136945799 16:34649248-34649270 TAGTACCAGAAAATAACCCATGG - Intergenic
1136948643 16:34687832-34687854 TAGTACGAGAAAAGAACCCATGG - Intergenic
1136956135 16:34788281-34788303 TAGTACCAGAAAAGAACCCATGG - Intergenic
1136963902 16:34883871-34883893 TAGTACCAGAAAAGAACCCATGG - Intergenic
1137088535 16:36159113-36159135 TAGTACCAGAAAAGAACCCATGG - Intergenic
1137220149 16:46441218-46441240 TAGTACCAGAAAAGAACCCAGGG + Intergenic
1139174282 16:64668924-64668946 CAATCATAGAAAATAAACTATGG + Intergenic
1144218773 17:13081272-13081294 TAGGCCTAGAAAATGAAAGAAGG - Intergenic
1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG + Intronic
1145290289 17:21539229-21539251 TTCTCCTATAAAAGAAACCAAGG + Intronic
1145708811 17:26948957-26948979 TAGTACCAGAAAAGAACCCATGG - Intergenic
1149224301 17:54451070-54451092 TATTGGTAGAAAATAATCCACGG - Intergenic
1149884394 17:60326597-60326619 TAGAATGAGAAAATAAACCATGG - Intronic
1150802868 17:68295539-68295561 AAGTCCTAGAAAACAAACCCAGG + Intronic
1151071941 17:71224582-71224604 TAGAGCTAGAAAATGAGCCAGGG - Intergenic
1153207514 18:2719142-2719164 AATTCCTAGAAAATAAAACAGGG - Intronic
1153248697 18:3098625-3098647 CATTCCTGGAAAAGAAACCAAGG + Intronic
1153977804 18:10284795-10284817 TAGTGCTGGAAAATAAAACTCGG + Intergenic
1154519454 18:15211749-15211771 TAGTACCAGAAAAGAAACCATGG + Intergenic
1156188632 18:34692384-34692406 TATTCCGAGAAAAAAAACTAGGG + Intronic
1156616374 18:38790332-38790354 TTGCCATAGAAAATTAACCATGG + Intergenic
1156995649 18:43463780-43463802 TAGACCTATAAAATGAACAAAGG + Intergenic
1157851449 18:51056178-51056200 TAGTGATAGAAAATAAAAGAAGG + Intronic
1158464286 18:57676006-57676028 TGCTCTTAGAAAATAAGCCAGGG - Intronic
1158502474 18:58015515-58015537 TAGTGGTAGAAAATAAAGAAGGG - Intergenic
1158527322 18:58226809-58226831 CAGAGCTAGAAAACAAACCAGGG + Intronic
1158608075 18:58913685-58913707 TAGTGCTAGAAAATAAGACTGGG + Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1159979465 18:74759591-74759613 TAGTCACAGAAAATACAGCAAGG - Intronic
1163285636 19:16345506-16345528 TAGAACCGGAAAATAAACCAGGG + Intergenic
1164022804 19:21323621-21323643 TAGACTTTGAAAATAAAACAAGG - Intronic
1164994387 19:32708952-32708974 CAGAACTAGTAAATAAACCAGGG - Intronic
1167321464 19:48799504-48799526 TGGTCCCTGAAAACAAACCATGG - Intronic
1168362229 19:55751423-55751445 TAGTCCCAGAAAATAAGAAAAGG - Intergenic
926026063 2:9545667-9545689 TTGTCCTTGAAAATAAGGCAAGG - Intronic
926386201 2:12338076-12338098 TAGTCCAAGACTATCAACCAAGG - Intergenic
929972242 2:46592263-46592285 TAGTGCTAGAAGATAAAACCAGG + Intronic
930773108 2:55147451-55147473 TAGTCCTGGATTATAACCCAAGG - Intergenic
932500665 2:72180235-72180257 TATTCCTAGAACACAAACCATGG + Intronic
934249712 2:90339894-90339916 TAGTACCAGAAAAGAACCCATGG + Intergenic
934259863 2:91463552-91463574 TAGTACCAGAAAAGAACCCATGG - Intergenic
934303171 2:91795480-91795502 TAGTACCAGAAAAGAACCCATGG - Intergenic
934330088 2:92057276-92057298 TAGTACCAGAAAAGAACCCATGG + Intergenic
934468313 2:94287185-94287207 TAGTACCAGAAAAGAACCCATGG + Intergenic
936019864 2:108986742-108986764 TTTTCCTAAAAAATAAAGCAAGG - Intronic
936495899 2:113020587-113020609 TTGTCCTAGCATATAAAGCAGGG - Intergenic
936888509 2:117341418-117341440 TAGACCTAAAAAAGAGACCAAGG - Intergenic
936903932 2:117514929-117514951 TATTCCAAGAAAATAAATCCAGG - Intergenic
938519433 2:132052377-132052399 TAGTACCAGAAAAGAACCCATGG + Intergenic
941341922 2:164316845-164316867 TTGTCATAGAAAATAAACAAAGG - Intergenic
942374563 2:175323870-175323892 TACTCCCAGAAAGTAAGCCAGGG - Intergenic
944332660 2:198489869-198489891 TTCTCCAATAAAATAAACCAGGG - Intronic
948819836 2:240536088-240536110 TACTCCTATAAGATAAACCATGG + Intronic
1170933319 20:20788912-20788934 TTCTCCAAAAAAATAAACCATGG + Intergenic
1173270375 20:41528905-41528927 TAGTCCTTGAAAGGATACCATGG + Intronic
1173987640 20:47274804-47274826 CAGTTCTTGAAAATAACCCAAGG + Intronic
1173989003 20:47285642-47285664 TATTCCTAAAAATTAAACTAAGG + Intronic
1176585570 21:8581167-8581189 TAGTACCAGAAAAGAACCCATGG - Intergenic
1176777554 21:13151987-13152009 TAGTACCAGAAAAGAAACTATGG - Intergenic
1177203760 21:17987217-17987239 TATTCCTAAAAACTAAGCCAGGG + Intronic
1177531094 21:22359150-22359172 TAGCCCTAGCAAATACACAAGGG + Intergenic
1177573108 21:22914997-22915019 TAGTGAAAGAAAATTAACCAAGG - Intergenic
1179006068 21:37516409-37516431 CAGGCCTAGATAAGAAACCAGGG - Intronic
1179232051 21:39512942-39512964 TTGCCCTAGAGAATAAACTATGG - Intronic
1180268379 22:10558066-10558088 TAGTACCAGAAAAGAACCCATGG - Intergenic
1180525165 22:16251452-16251474 TAGTACCAGAAAAGAACCCATGG - Intergenic
1181668505 22:24414411-24414433 TAGGCCTAGAAAATATTTCAAGG + Intronic
1181734610 22:24871812-24871834 AAGCCCCAGAAAATCAACCAAGG - Intronic
1203237432 22_KI270732v1_random:18516-18538 TAGTACCAGAAAAGAACCCATGG - Intergenic
1203290364 22_KI270735v1_random:31558-31580 TAGTACCAGAAAAGAACCCATGG + Intergenic
949122973 3:410087-410109 TAGAACTAGAAATTAAACCCTGG + Intergenic
949185190 3:1182352-1182374 GAGCCCTAGAAAGTAAATCATGG + Intronic
951476787 3:23115179-23115201 TGGTTCTAGAAATTAAACCATGG - Intergenic
951956642 3:28262685-28262707 GAGTCCTGAAAAATAAACAAAGG - Intronic
952224443 3:31360599-31360621 TAGTGCTAAGAAATATACCAGGG - Intergenic
954719688 3:52550716-52550738 AAGTCCTAGAAAATCAAACTGGG + Intronic
955952950 3:64260572-64260594 CAGTCCAAATAAATAAACCATGG + Intronic
957509064 3:81164111-81164133 TAATACTACAAAATTAACCATGG + Intergenic
957938239 3:86970875-86970897 TAGTGAAAGAAAGTAAACCATGG - Intronic
960026343 3:113015044-113015066 TACTTCTAGAAATTGAACCAAGG - Intronic
960703998 3:120464641-120464663 TAGTCCTAGAAAAGGAAAAAAGG - Intergenic
961277470 3:125739056-125739078 TAGTCCTTAAAAATATTCCAAGG - Intergenic
962098780 3:132319961-132319983 TAGTCCGAGAACAAGAACCAAGG - Intronic
962509276 3:136082827-136082849 GAGTCCTTGAAAATAAAACTTGG - Intronic
963184912 3:142403985-142404007 TATACCTAGAAAATAAATCAAGG + Exonic
964459786 3:156911601-156911623 AAATCCTAGAAAAAAAACCTAGG - Intronic
964754231 3:160079678-160079700 AAGTCCAAGAAAGTAAAGCAAGG - Intergenic
966427489 3:179795021-179795043 TAGTCTTAAAAAATTAACAAAGG + Exonic
966649931 3:182288919-182288941 TAGTGTTAAATAATAAACCAAGG - Intergenic
970250489 4:14110492-14110514 TAAACATAGAAAATAAACCCAGG + Intergenic
970921014 4:21395226-21395248 TACTCCCAGAAGAGAAACCAAGG + Intronic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
972398757 4:38680569-38680591 TTGGCCTAGAAAACAAAACAAGG - Exonic
973988291 4:56377245-56377267 TAGTCCTAGAAAATCAAAGGAGG - Intronic
976250467 4:83045516-83045538 TAGTACTATGAAAGAAACCAAGG + Intronic
979123821 4:116940727-116940749 AATTCCTATAAAATAAAACAAGG + Intergenic
979145068 4:117236214-117236236 TATTCATAGAAAAAAAGCCAAGG + Intergenic
979647454 4:123088094-123088116 TAGTACAGAAAAATAAACCAAGG - Intronic
981314980 4:143333065-143333087 TATTTCTAGAAATTAAATCAGGG - Intergenic
981399915 4:144301905-144301927 TAGTTTTAGAAGCTAAACCAGGG + Intergenic
981766188 4:148252869-148252891 TTGTTCCAGAAAATAATCCAAGG - Intronic
982302408 4:153893044-153893066 TAGTCCAAGGAAATATGCCAAGG - Intergenic
982538130 4:156632185-156632207 TATTAATAGAAAATAACCCAAGG + Intergenic
982946657 4:161632818-161632840 AACTCTTAGAAAATAAACAAGGG + Intronic
984083228 4:175276397-175276419 AAGTTCTAGAAAATAAATAATGG + Intergenic
984449972 4:179887335-179887357 AAATCCTAGAAAAAAAACCTAGG + Intergenic
984463716 4:180070645-180070667 CAGTCCCAGAAAATGAAGCAGGG - Intergenic
984795223 4:183654107-183654129 TAGTACTAGAAAAAAATACACGG + Intronic
987265311 5:16247232-16247254 TGCTCTTAGAAAATAGACCAAGG - Intergenic
987775986 5:22367061-22367083 TACTTCTAGAAAATAATCGAAGG + Intronic
988635283 5:32977320-32977342 TAGTTGTAGAAATTAAGCCAAGG - Intergenic
991388161 5:66113245-66113267 TAGTCCTAGAAAAAAACATAGGG + Intergenic
992285120 5:75226980-75227002 TAGTGCTAAAAAAAAAACCGTGG - Intronic
993161022 5:84291064-84291086 TAGTACTAGAAAAAAATGCAAGG + Intronic
994342780 5:98651556-98651578 CAGTCTTATATAATAAACCAAGG + Intergenic
994419190 5:99511353-99511375 TACTCCCAGAAAACAAATCAGGG - Intergenic
996010467 5:118476959-118476981 CAGTCCTGAAAAATAAGCCATGG + Intergenic
996038126 5:118781350-118781372 AAGACCTAGAAATTACACCAGGG + Intergenic
998342259 5:141428412-141428434 TAGTCTTAGAACAGAGACCAGGG - Intronic
998694118 5:144618524-144618546 TAGTCCTAGAACATAGATCTTGG - Intergenic
998964569 5:147525223-147525245 TTCTCCTATAAATTAAACCATGG + Intergenic
999728106 5:154453678-154453700 CAGTTCCAGAAAAGAAACCATGG + Intronic
999866636 5:155707361-155707383 TGGAGCTAGAATATAAACCAAGG + Intergenic
1000465977 5:161577337-161577359 TAGTACTGGAAAATATATCATGG + Intronic
1004999561 6:21227136-21227158 TAGTTCTAGAAAGTAAACAGAGG - Intronic
1006293533 6:33159050-33159072 TAGTCCTTGAATAAAGACCAAGG - Intergenic
1006450868 6:34105027-34105049 CAGGCCGAGAAAATTAACCATGG + Intronic
1007852110 6:44813080-44813102 TATTCCTAGAAAATATCCCTAGG - Intronic
1009962728 6:70543587-70543609 TATTCCTACAAAATGAAACATGG + Intronic
1012072146 6:94636382-94636404 TATTACTAGAAAATTAACAAGGG - Intergenic
1012557953 6:100539169-100539191 TAGTGCTAGACAATAAATGATGG - Intronic
1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG + Intergenic
1015087787 6:129316281-129316303 TAATGATAGAAGATAAACCATGG + Intronic
1015800032 6:137051376-137051398 TTCTCCAATAAAATAAACCAGGG - Intergenic
1017228499 6:152047137-152047159 TTCTACTAGAAAATAAAACAGGG - Intronic
1017585197 6:155913198-155913220 TAGAGCTAGAAATTAAACCCAGG + Intergenic
1021254094 7:18368541-18368563 TTTTCCCAGAAAATAAAGCACGG - Intronic
1021899423 7:25268781-25268803 TGGTCCTACAGAATAAACCCTGG - Intergenic
1022238327 7:28484309-28484331 TAGACCATAAAAATAAACCATGG + Intronic
1022774113 7:33506887-33506909 TAATACTAGAAAATAAATAATGG + Intronic
1022864604 7:34404890-34404912 AAGACCCAGAAAAGAAACCAGGG + Intergenic
1022921402 7:35019273-35019295 TACTCCTAGAAAGGAAACCCAGG + Intronic
1024805554 7:53135465-53135487 TAGTACCAGAAAAGAACCCATGG + Intergenic
1025837630 7:65109629-65109651 TAGTACCAGAAAAGAACCCATGG - Intergenic
1025885443 7:65586369-65586391 TAGTACCAGAAAAGAACCCATGG + Intergenic
1027500150 7:78939951-78939973 GAGTCATAGAAAATAAACACAGG + Intronic
1027945317 7:84737665-84737687 TATTCCAATAAAAGAAACCAGGG - Intergenic
1028088663 7:86670058-86670080 CAGTGATAGAAAACAAACCAGGG - Intronic
1028295334 7:89122823-89122845 TAGACAGAGAAAATAAACCAAGG - Intronic
1029039253 7:97555807-97555829 TAGTCTGTGAAAATAAAACATGG - Intergenic
1031210393 7:118817896-118817918 TAATCAGAGAAAATCAACCATGG + Intergenic
1031464043 7:122086111-122086133 TAATCCTGGAAAAAAATCCATGG + Exonic
1031481005 7:122278565-122278587 GAATCCTAGAAAAAAAACCTAGG - Intergenic
1031745107 7:125486440-125486462 TTGTCCAATAAAATAAACCAGGG + Intergenic
1032112934 7:129092116-129092138 TGGTCCTGGAACCTAAACCAAGG - Intergenic
1035868025 8:3106000-3106022 TAGTCCTAGAAAATAAACCAAGG - Intronic
1037067480 8:14600137-14600159 AAGTCCAAGTAAAGAAACCATGG - Intronic
1039996100 8:42534556-42534578 TGATCCTAGAAAATAACCTAGGG + Intronic
1040492487 8:47937569-47937591 AAGTCCTAGAAAAGAAGCCTTGG - Intronic
1040510765 8:48092142-48092164 TACTACTTGAAAATAAACAAAGG - Intergenic
1042344983 8:67718114-67718136 TAGACCCAGAGAATGAACCAAGG - Intronic
1042670796 8:71261422-71261444 TACACATAAAAAATAAACCATGG + Intronic
1043085298 8:75824253-75824275 AAGTCCAAGAAAATAAAGTAAGG + Intergenic
1043172644 8:76984657-76984679 TAGTGCTGGAAAATAAACTGAGG - Intronic
1043858421 8:85288150-85288172 TAGTTCTGGAAAAAAAACAAAGG + Intergenic
1043914922 8:85911234-85911256 TAGTTTTAAAAACTAAACCATGG + Intergenic
1043975075 8:86575662-86575684 AAGTCCTAGAAACTAAGCTAGGG + Exonic
1044543582 8:93434864-93434886 AAATCCTAGAAATTAAACCTAGG + Intergenic
1045747173 8:105436750-105436772 TAGTTCAGAAAAATAAACCAAGG - Intronic
1045778389 8:105834286-105834308 GAGATCTAGAACATAAACCAAGG + Intergenic
1045811852 8:106231148-106231170 TAATCCCAGAAACTAAACAATGG + Intergenic
1046001342 8:108424227-108424249 TATTTCTAGAAAATAATCCATGG + Intronic
1047947460 8:129895927-129895949 CAGTCTTACAAAATAATCCAAGG - Intronic
1048200416 8:132369452-132369474 TTGTCCAATAAAAGAAACCAGGG + Intronic
1052205473 9:25834318-25834340 TATTCTTATAAAATAAACCCTGG - Intergenic
1053698718 9:40665209-40665231 TAGTACCAGAAAAGAACCCATGG + Intergenic
1053944723 9:43295442-43295464 TAGTACCAGAAAAGAACCCATGG + Intergenic
1054310007 9:63464610-63464632 TAGTACCAGAAAAGAACCCATGG + Intergenic
1054867143 9:70014246-70014268 CAGGCCTAGAAACTAAACCCAGG - Intergenic
1055209751 9:73776784-73776806 TTGTCCTATAAAATTAACTAGGG - Intergenic
1055273857 9:74592160-74592182 CATCCCTAGAAAATAAACAATGG + Intronic
1055629393 9:78207876-78207898 TATTCCTAGAATATCAACCTGGG + Intergenic
1059860436 9:118454588-118454610 TAGTCCTAGAAGGTAAACATAGG - Intergenic
1203581456 Un_KI270746v1:9671-9693 TAGTACCAGAAAAGAACCCATGG - Intergenic
1203587858 Un_KI270747v1:24020-24042 TAGTACCAGAAAAGAACCCATGG + Intergenic
1185821233 X:3206844-3206866 TATTGCTAGGAAAGAAACCAAGG - Intergenic
1188306339 X:28563808-28563830 TAGTCCTAGAAAGTATATAATGG - Intergenic
1191935774 X:66425858-66425880 AAATCCTAGAAAAAAAATCAAGG + Intergenic
1193857270 X:86619615-86619637 CAGTGCTATTAAATAAACCATGG + Intronic
1196128379 X:112124853-112124875 TACTCCAAGAAAATACATCAAGG - Intergenic
1201510526 Y:14755944-14755966 TAATCCTAGAAATTACAACATGG + Intronic
1201617825 Y:15921167-15921189 TAGTTAAAGAAAATAAACCCAGG - Intergenic
1202112609 Y:21439276-21439298 AAGGCCTAGAAGATAAACCTAGG - Intergenic