ID: 1035872203

View in Genome Browser
Species Human (GRCh38)
Location 8:3147971-3147993
Sequence TAATGCTGTTAGGGTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035872203 Original CRISPR TAATGCTGTTAGGGTGATCT TGG (reversed) Intronic
909239296 1:73191836-73191858 TAGGGATGTGAGGGTGATCTGGG - Intergenic
912889240 1:113510936-113510958 TATTAATGTTATGGTGATCTAGG - Intronic
916570754 1:166025205-166025227 AAATGCTGTGAGGGTGAACCAGG - Intergenic
916778186 1:167991864-167991886 TAATCCAGTTAGGGTGAGGTGGG + Intronic
917483476 1:175433363-175433385 TGATGCTTTGAGGGTGACCTGGG + Intronic
923030805 1:230247743-230247765 AAATGCTCTTAGGGTGAACGTGG - Intronic
923454262 1:234149521-234149543 TACAGCTGTTAGGGTATTCTAGG - Intronic
924575824 1:245280155-245280177 AACTGCTGTTAGGGGGTTCTGGG - Intronic
1066670276 10:37829833-37829855 TGATTCTGTTGGGGTGAACTTGG - Exonic
1068199258 10:53761770-53761792 TAAGGGTATTAGGGTGTTCTGGG - Intergenic
1068912867 10:62397332-62397354 TGATCCTGTTAGGCTGAGCTTGG + Intronic
1071449656 10:85782150-85782172 TATTGCTGTTATTGTGATTTTGG - Intronic
1071677211 10:87666012-87666034 AAGTGCTGTTGGCGTGATCTTGG + Intronic
1078069654 11:8100109-8100131 AAAGGCTGTTAGAATGATCTTGG + Intronic
1078128335 11:8591162-8591184 TACTGCTGTAAGGGAGATTTAGG - Intronic
1079281837 11:19094365-19094387 TGATGCTTTAAGGGTGCTCTGGG - Intergenic
1080068145 11:28044086-28044108 TAATGGGGTAAGGGAGATCTGGG - Intronic
1081266166 11:41024933-41024955 TATATCTGTTATGGTGATCTGGG + Intronic
1081481994 11:43498135-43498157 TAAAGCTGTTAGAATAATCTTGG - Intergenic
1081717271 11:45259265-45259287 TAAGACTGTTTGGGTGGTCTGGG + Intronic
1082261274 11:50077682-50077704 TAATGATGTTAGTGTGAGGTAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085856045 11:80177376-80177398 TTTTGCTGTTAGGGTGATGCTGG + Intergenic
1087998498 11:104842899-104842921 AAATGCTGATAGGTTTATCTAGG - Intergenic
1092934793 12:13350755-13350777 TAAAGCTGATAAGTTGATCTAGG + Intergenic
1093585245 12:20828191-20828213 TAATGCTTTTACGGTGCACTTGG + Intronic
1093788512 12:23219627-23219649 TAATGCTAATAGTGTGGTCTGGG + Intergenic
1100718698 12:97332522-97332544 TAATGCTGTCACGGTTATGTAGG + Intergenic
1101085061 12:101227179-101227201 GATTGCTGTAAGGGTGATGTGGG + Intergenic
1102362821 12:112303099-112303121 TACTGATGTTGGGGTCATCTAGG - Intronic
1104345859 12:127997685-127997707 TAATGCTGCTAGGGGTATCCTGG - Intergenic
1106090599 13:26589722-26589744 TAATGCTGTTAGTGTAGTTTGGG + Intronic
1106325697 13:28686615-28686637 TATTGGTATTAGGGTGATATTGG + Intergenic
1107663274 13:42662234-42662256 TAATGCATTTTAGGTGATCTTGG + Intergenic
1109274231 13:60286310-60286332 AACTGCTGTTAGGGGGTTCTGGG - Intergenic
1109691936 13:65905991-65906013 TAATGAGGTTAGGGTTATCTAGG + Intergenic
1113434915 13:110283777-110283799 TTATGCTGGTGGGGTGAGCTTGG + Intronic
1114950048 14:27738976-27738998 TACATCTGTTAGGGTGCTCTGGG + Intergenic
1116280279 14:42898171-42898193 TAATGCTGTTAGTGTGGTGTTGG + Intergenic
1116492116 14:45517243-45517265 TAATTATGTTAGGGGAATCTTGG + Intergenic
1120634759 14:86938139-86938161 TAATGCACTTACGGTGATCTTGG - Intergenic
1122699570 14:103578834-103578856 CACTGCTGTTAGGGTGACCACGG - Intronic
1127011713 15:54638091-54638113 TAATGCTATAATGGTGATGTGGG + Intergenic
1131131995 15:89906156-89906178 AAAAGCTGTTAGGGTCACCTAGG - Intronic
1132552324 16:558690-558712 TACTGGTGTCAGGGTGACCTTGG + Intergenic
1132913341 16:2327345-2327367 AAATGCTATTAGGATGTTCTTGG + Intronic
1133650043 16:7804138-7804160 TACTGCTGGTAGGATCATCTTGG - Intergenic
1136590128 16:31213733-31213755 TAATCCTGCCAGGGTGACCTTGG + Intergenic
1138463454 16:57168451-57168473 TAATGTTTTTAGGGTCATCATGG + Intronic
1140079813 16:71735299-71735321 TAATACTGTTTGGCTTATCTAGG - Intronic
1141628340 16:85273352-85273374 TAATGCTGTTATGAACATCTGGG - Intergenic
1149910069 17:60558895-60558917 TAATGCTGTACGGGGGACCTGGG - Intergenic
1150323255 17:64234334-64234356 TACTGCTGTTAGGCAGATATTGG - Intronic
1151119790 17:71779934-71779956 TATATCTGTTATGGTGATCTGGG + Intergenic
1151214042 17:72565427-72565449 TAAGGCTGTTATGGTGGTCTTGG - Intergenic
1156003130 18:32408229-32408251 TAGTGATTTTAGGGTAATCTTGG - Intronic
1158064659 18:53391770-53391792 TGATGCTGTGAGGGTCAGCTGGG + Exonic
1164398271 19:27885251-27885273 AACTGCTGTTAGGGGGATTTGGG - Intergenic
1165324400 19:35105913-35105935 TAATGCTGGTGGCGTGATCATGG - Intergenic
926527087 2:13994078-13994100 TATTGATATTAGGGTGATATTGG + Intergenic
927803990 2:26128746-26128768 TAATGCTGAAAATGTGATCTTGG + Intronic
931472602 2:62553953-62553975 TAATCCAGCAAGGGTGATCTGGG - Intergenic
933986760 2:87598384-87598406 TAATGTTGTTATGGTCATTTAGG + Intergenic
936307083 2:111352425-111352447 TAATGTTGTTATGGTCATTTAGG - Intergenic
936511666 2:113153260-113153282 CCATGCTGTTAGGCTGCTCTCGG - Intergenic
940198410 2:151122777-151122799 TGAAGCTGGTAAGGTGATCTTGG - Intergenic
941392262 2:164928896-164928918 GGATACAGTTAGGGTGATCTTGG - Intronic
942343285 2:174973033-174973055 AAATAGTGTTAGGGTGATCCTGG - Intronic
942539905 2:177005086-177005108 TATATCTGTTATGGTGATCTGGG + Intergenic
943528241 2:189045897-189045919 TATTCTTGTTAGGGTGATCGTGG - Exonic
947573797 2:231256503-231256525 CCATGCTATTAGGGTGATTTGGG + Intronic
948045352 2:234939513-234939535 ATATGCTGTTAGGGAGACCTGGG + Intergenic
1169792321 20:9424627-9424649 CACTGCTGGCAGGGTGATCTTGG + Intronic
1172919409 20:38468634-38468656 TATTGCAGCCAGGGTGATCTTGG - Intergenic
1183179841 22:36252709-36252731 TAATGCCGTTGGGGTTATTTTGG - Intergenic
1183912438 22:41090016-41090038 TACTGCAGTTTGGGTGATCTAGG + Intergenic
949616240 3:5756853-5756875 TAATCCTGTTGGGGACATCTTGG + Intergenic
951153446 3:19320665-19320687 TTTTGGTGTTAGGGTGATATTGG + Intronic
952871952 3:37908906-37908928 TATTGCTGTTGGAGTGGTCTTGG + Intronic
953758326 3:45666575-45666597 GAAGGCTGTTGGGGGGATCTGGG - Intronic
956140230 3:66138953-66138975 TACTCCTGTTAGTGTGAACTTGG - Intronic
963498048 3:146094087-146094109 TTATGCAGTTAGGCTGCTCTGGG + Intronic
964406522 3:156354211-156354233 TAATGGCGTTGGTGTGATCTCGG + Intronic
965948179 3:174268383-174268405 TAAGGCTGTTAGCGTTTTCTGGG - Intronic
966722866 3:183081754-183081776 TAATGCTGTTCAGGGGCTCTTGG + Intronic
967786316 3:193500788-193500810 TAATGCTGTTATTGTCATCAAGG + Intronic
969158995 4:5238963-5238985 TAATGCTTTTAGAGAGATTTGGG + Intronic
971510049 4:27413572-27413594 TAATGCTGTTTGTGTTATTTTGG - Intergenic
973053382 4:45623187-45623209 TAAAGGTGTTAGGATTATCTAGG + Intergenic
974791748 4:66699543-66699565 TATATCTGTTATGGTGATCTTGG - Intergenic
974801539 4:66824954-66824976 TGATGTTATTAGGGTGATGTTGG + Intergenic
974980417 4:68949492-68949514 TATATCTGTTACGGTGATCTGGG - Intronic
976571005 4:86610796-86610818 TAAGGCTGTTAAGATAATCTAGG - Intronic
979556654 4:122055654-122055676 TGATGCTGACAGGGTGAACTCGG - Intergenic
981287743 4:143039714-143039736 TTATGCTGATATGGTGATATTGG + Intergenic
981858646 4:149327286-149327308 TAGTCCTGTTTGAGTGATCTTGG - Intergenic
983300875 4:165923918-165923940 TATATCTGTTATGGTGATCTGGG + Intronic
986556274 5:9012929-9012951 CATTACTGTTTGGGTGATCTGGG - Intergenic
986977909 5:13413823-13413845 TAGTTCTGATGGGGTGATCTGGG + Intergenic
987172227 5:15270730-15270752 TAATGATGCTAGGGTAAGCTAGG + Intergenic
990427497 5:55701530-55701552 GAATGCTGTTGTGGTAATCTTGG - Intronic
992414910 5:76543159-76543181 TCATGCTGCGAGGGTGTTCTGGG - Intronic
992777723 5:80103081-80103103 TAATGCTGATAGACTGAGCTGGG + Intergenic
993572337 5:89557077-89557099 CAATGCTGGTATGCTGATCTTGG - Intergenic
994727185 5:103450689-103450711 CAATGCTGTTAGGTTACTCTGGG + Intergenic
995008673 5:107232717-107232739 CAATGCTGTCAGGCTGATTTAGG - Intergenic
996325714 5:122270709-122270731 TTTTGGTGTTAGGGTGATCCTGG - Intergenic
997211798 5:132081255-132081277 TAAGGCTGTCAGGGTGATGAGGG - Intergenic
998713175 5:144849528-144849550 ACATCCTGTTAGGGTAATCTTGG + Intergenic
999436998 5:151570871-151570893 GAATGCTGTCAGCATGATCTTGG - Intergenic
1002336264 5:178480480-178480502 CAATGGTGTTAGTGGGATCTTGG - Intronic
1003063459 6:2880942-2880964 TTTTGCTATTAGGGTGATGTTGG - Intergenic
1007246133 6:40464398-40464420 TAATGCTGTTATGGTGGAGTAGG + Intronic
1009401509 6:63261894-63261916 TAATTCTGTTTAGGTGAACTGGG + Intergenic
1013396900 6:109750311-109750333 CATGGCTGTTAGGGGGATCTTGG + Intronic
1014741384 6:125151453-125151475 TATATCTGTTATGGTGATCTGGG + Intronic
1016181126 6:141149293-141149315 AAATGCTGTTAGGGCGTTTTGGG + Intergenic
1018666993 6:166147920-166147942 CACTGCTATTAGGGTGATCACGG - Intergenic
1019812944 7:3178174-3178196 TAATGCTCTTAGGGTTTTCCAGG - Intergenic
1020678104 7:11203885-11203907 TCATGCAATTAGGGTGAGCTGGG - Intergenic
1022203167 7:28137516-28137538 AAATGCTGTTAAGGAGACCTGGG - Intronic
1024877295 7:54040374-54040396 TATAACTGTTATGGTGATCTGGG - Intergenic
1028761261 7:94499147-94499169 TAATGCTGTTAGCAGCATCTTGG - Intergenic
1031414378 7:121478227-121478249 TGATGATGTTAGGGAGATCTGGG - Intergenic
1034878597 7:154746614-154746636 TAATGCTTTTTGGGTGATTGTGG - Intronic
1035872203 8:3147971-3147993 TAATGCTGTTAGGGTGATCTTGG - Intronic
1036009587 8:4707124-4707146 GAAAGCTGTTACAGTGATCTGGG + Intronic
1038069014 8:23992845-23992867 TAATGCTTTAGCGGTGATCTGGG + Intergenic
1038944881 8:32347779-32347801 TCATGCTGTGAGGGTGATGAGGG + Intronic
1041602638 8:59738313-59738335 TAATGCTGTTAGGGAGAAATTGG - Intergenic
1043593915 8:81862420-81862442 TAATACAGTTAGGGAAATCTAGG - Intergenic
1045103337 8:98867018-98867040 TGATCCTGAAAGGGTGATCTGGG + Intronic
1046395852 8:113638089-113638111 CAGTGCTGTTATGGTGATATAGG + Intergenic
1047391079 8:124451830-124451852 TATTGCAGATAGGGTGATCCTGG + Exonic
1051053645 9:12958280-12958302 ACATGCTGTTAGGGTGAACTTGG - Intergenic
1051312915 9:15795624-15795646 TAATAATGTTAGGGAAATCTAGG + Intronic
1057452906 9:95181545-95181567 AAATGCTGGCAGAGTGATCTTGG + Intronic
1059193511 9:112349100-112349122 TTATGCTAATAGGGTGATTTAGG + Intergenic
1062020197 9:134315758-134315780 CAAGGCGGTTAGGGTGGTCTTGG + Intergenic
1188058360 X:25568273-25568295 TTTTGGTGTTAGGGTGATATTGG + Intergenic
1188729679 X:33631170-33631192 TAATGCTGCTAGGGGGATGGGGG + Intergenic
1192827213 X:74709844-74709866 TATTCCTGTTAGGGTGGACTAGG - Intergenic
1197956302 X:131952227-131952249 TTTTGGTATTAGGGTGATCTTGG - Intergenic
1197956467 X:131954666-131954688 TTTTGGTATTAGGGTGATCTTGG + Intergenic
1198556670 X:137800782-137800804 TGATGCAGTTAGGGTTAGCTTGG - Intergenic
1198733745 X:139763334-139763356 CAATGATGTTAGTATGATCTTGG - Exonic
1198921337 X:141731653-141731675 TATTGCTGTTAGGTTCATTTGGG + Intergenic