ID: 1035875941

View in Genome Browser
Species Human (GRCh38)
Location 8:3189796-3189818
Sequence CTGGCTCATGACCCATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035875941_1035875944 -4 Left 1035875941 8:3189796-3189818 CCTTTAAATGGGTCATGAGCCAG 0: 1
1: 0
2: 4
3: 11
4: 89
Right 1035875944 8:3189815-3189837 CCAGATGGATTTACGTAGCCTGG 0: 1
1: 2
2: 0
3: 5
4: 39
1035875941_1035875946 23 Left 1035875941 8:3189796-3189818 CCTTTAAATGGGTCATGAGCCAG 0: 1
1: 0
2: 4
3: 11
4: 89
Right 1035875946 8:3189842-3189864 AAACATGAGAAGTAACTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035875941 Original CRISPR CTGGCTCATGACCCATTTAA AGG (reversed) Intronic
900766008 1:4505917-4505939 GTGGCTCATAACACATTTAAGGG - Intergenic
901965533 1:12863108-12863130 CTGGCTCATGACCCTGTCAAGGG - Intronic
901980933 1:13033486-13033508 CTGGCTCATGACCCAGTCAAGGG - Intronic
902001154 1:13195444-13195466 CTGGCTCATGACCCAGTCAAGGG + Intergenic
902020387 1:13341148-13341170 CTGGCTCATGACCCAGTCAAGGG + Intergenic
905420151 1:37837015-37837037 CTGAGTCATGATCCCTTTAAGGG - Intronic
905643845 1:39610500-39610522 CTCACTCAGGACCCAGTTAATGG - Intergenic
906845342 1:49185696-49185718 CTGCTTCATGACCCAGTTTAGGG + Intronic
913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG + Intronic
922179408 1:223222175-223222197 CTGGATCTTGACCCATATTAGGG + Exonic
924674108 1:246158036-246158058 CTGGCTCTTTACTTATTTAAAGG - Intronic
1068900805 10:62268155-62268177 CTGGCTTATTACGGATTTAATGG - Intronic
1071029672 10:81161728-81161750 CTGTCTCTTGATCCATTTCATGG - Intergenic
1076083944 10:127608349-127608371 CTGGGTTGTGACCCAGTTAATGG - Intergenic
1081314079 11:41610281-41610303 CTGGCTCATGAACCACATACAGG + Intergenic
1084872967 11:72110025-72110047 CTTGCTCCTGACCCAGTTGATGG - Exonic
1086934068 11:92724822-92724844 CTGGCTTTGGACCCATTTAATGG - Intronic
1088774014 11:113064256-113064278 CAGTCTCATGACCCATTTCAAGG - Intronic
1088952041 11:114581672-114581694 CTAGTTCTAGACCCATTTAAAGG - Intronic
1090229771 11:125093103-125093125 CTGGGGTATGACCAATTTAACGG + Intergenic
1099385233 12:82005954-82005976 CAGTCTCTTTACCCATTTAATGG - Intergenic
1107076407 13:36325526-36325548 ATGAGTCAAGACCCATTTAATGG + Intronic
1108713207 13:53054506-53054528 CTTGTTCATGAACCATTGAAAGG + Intergenic
1110338831 13:74365034-74365056 CTGGCTCATCACCAAGTTCATGG - Intergenic
1110475189 13:75905948-75905970 ATGGCTCATGAGCCACTAAACGG - Intergenic
1111859495 13:93683983-93684005 CTCTCTCATGACCCTTTTAAGGG + Intronic
1116316041 14:43393018-43393040 TTGGCTCATGACACATTTTGGGG + Intergenic
1117403169 14:55376413-55376435 ATGGCTCATGAACCAATGAATGG + Intronic
1117774972 14:59174433-59174455 CATGCTCATCACCCATTTGATGG - Intergenic
1121387384 14:93540589-93540611 CTAGATCATGACCCATTCAGAGG - Intronic
1127602727 15:60554516-60554538 AGGGCTAATGACCCATTGAAAGG + Intronic
1132007356 15:98240745-98240767 ATGGCACATGACCCACTAAAAGG - Intergenic
1139335705 16:66229605-66229627 CTGGCCCATGACCCATAAAGAGG + Intergenic
1140884184 16:79228586-79228608 CTGGCTCATGCCCTTTTCAATGG + Intergenic
1146681511 17:34811591-34811613 CTTGTTCATATCCCATTTAAGGG - Intergenic
1148988985 17:51648912-51648934 CTGGCTCATTACCAATCTATGGG + Intronic
1151254576 17:72866024-72866046 CTGGTTCATGACCCAGGTATTGG - Intronic
1151305406 17:73259960-73259982 CTGGCTCATGGCTCATGTAGAGG - Intronic
1153486965 18:5608620-5608642 CTGGCTCATAATCAATTTAAAGG + Intronic
1163071912 19:14850232-14850254 CTCACTCCTGACCCATTTTATGG + Intergenic
1165304806 19:34996866-34996888 GTAGGTCAAGACCCATTTAAGGG + Intronic
1167758597 19:51428806-51428828 CGGGCTCATGGCCCATTTCTTGG - Intergenic
924960972 2:34273-34295 CTGGCTGATGGCCCATTTGCTGG - Intergenic
928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG + Intergenic
929357248 2:41040656-41040678 TTGTTTCAAGACCCATTTAATGG - Intergenic
931889554 2:66656092-66656114 AAGGCTCATGTCCCATATAATGG + Intergenic
938803116 2:134781248-134781270 CTGGGTCATGACCTATTCATAGG + Intergenic
940353144 2:152711108-152711130 CTGGCTAATGCCCAATTCAATGG + Intronic
944501081 2:200360806-200360828 ATGGCACATGACCCATTGAGGGG + Intronic
946009992 2:216557011-216557033 CTGTCTCCTGAGCCATTCAAAGG - Intronic
947333582 2:229056250-229056272 ATGACTCATGCCCCAATTAACGG + Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948149840 2:235736424-235736446 TTGGCCCATGGCCCATGTAATGG - Intronic
1169575976 20:6961769-6961791 CTGTCCCATGAGCCATATAAAGG - Intergenic
1169765758 20:9146328-9146350 GTAGCTCATGGCCCATTTGATGG + Intronic
1172487065 20:35304724-35304746 CTGGATGATGACCATTTTAATGG - Intronic
1177240546 21:18450652-18450674 GTGGGCCATGACCCACTTAAAGG + Intronic
1177712214 21:24792594-24792616 CTGGCTCATGAATGATTCAAAGG + Intergenic
1183037301 22:35150023-35150045 ATGGCTCATGACCCCTTTCCTGG + Intergenic
949187644 3:1211949-1211971 ATGGCCCATGAACCATTTCATGG - Intronic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
953542313 3:43832738-43832760 ATAGCACAGGACCCATTTAAAGG - Intergenic
953789771 3:45938351-45938373 GTAGGTCATGACCCATTTAGTGG + Intronic
963513374 3:146277016-146277038 CTGGCTCATGGCTAATTTAGGGG - Intergenic
967522459 3:190449796-190449818 CTGGATCTTGACATATTTAAAGG + Exonic
970646879 4:18132197-18132219 CTGGCTCAGGACTAATCTAATGG + Intergenic
971344760 4:25801856-25801878 CTTGCTCATCACACATTGAAAGG + Intronic
972184223 4:36508786-36508808 CTTGCTCATGACCATTTTCATGG - Intergenic
972805931 4:42529453-42529475 CTGGTGCATGACCCACTTGATGG - Intronic
976835256 4:89364972-89364994 CAAGCTCATGCCCCATTTAAAGG + Intergenic
979585486 4:122410565-122410587 CTTGATCATTACACATTTAATGG - Intronic
984798062 4:183684783-183684805 CTACCTCATGGCCCAATTAAAGG + Exonic
984931400 4:184850527-184850549 CAGGCTCATGTCCCAATTCAAGG - Intergenic
991483953 5:67114374-67114396 GTGTCTCAGGACCCATTTTATGG - Intronic
992648158 5:78831488-78831510 ATGGGACATGACTCATTTAAAGG - Intronic
993853157 5:93036583-93036605 CTGGCTCATGAACCCAATAAGGG - Intergenic
994152858 5:96469017-96469039 CTGGCTAAAAACACATTTAATGG + Intergenic
995169237 5:109087959-109087981 TTGGCTCATGACCCATTAATAGG + Intronic
996851796 5:127961594-127961616 CTGACTCAGGACCTATTTCAAGG - Intergenic
997962188 5:138331115-138331137 CTGGCTCAGGACCCAGTTTTAGG - Exonic
998335247 5:141365801-141365823 CTGGCTGAAGACACATTTCAGGG + Exonic
1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG + Intronic
1007180978 6:39929038-39929060 GTGGCTCTTGACCCAGTCAAGGG - Intronic
1018269299 6:162058603-162058625 CTGACTCATGACACATGCAATGG + Intronic
1019929388 7:4213620-4213642 CTGGGTAATGACCCATGGAATGG - Intronic
1022602662 7:31776455-31776477 TTGCCTCGTGACCCATTAAAGGG - Intronic
1022719316 7:32928603-32928625 CTGGCTCATGCACCAACTAAAGG - Intergenic
1022738561 7:33099348-33099370 CTGGCTCATGCACCAACTAAAGG - Exonic
1030711898 7:112759304-112759326 CTGGCTGATGACCCCATGAAGGG + Intergenic
1035875941 8:3189796-3189818 CTGGCTCATGACCCATTTAAAGG - Intronic
1035876220 8:3192544-3192566 CTGGCTCGTGACCTATTTAAAGG - Intronic
1047446025 8:124920450-124920472 CTGCCTCCTGACCCATGCAATGG + Intergenic
1048006403 8:130422708-130422730 CTGGCTCCTGTCCCCTTTATGGG - Intronic
1050257179 9:3807289-3807311 CGAGCTCATGACCCATTCAGTGG + Intergenic
1050528478 9:6566331-6566353 TTGACACATTACCCATTTAAAGG - Intronic
1050810694 9:9743118-9743140 ATGGCTCATGAGCCATTGCAGGG - Intronic
1052736103 9:32344220-32344242 TTAACTCATGACACATTTAAAGG + Intergenic
1055913262 9:81374823-81374845 CTGACTCATAACCCAATTAATGG - Intergenic
1056739114 9:89237440-89237462 CTGTCTCATGACTCCTGTAAGGG - Intergenic
1059152265 9:111959707-111959729 CTGGCTCCTGAAGCATTTAGAGG - Intergenic
1187426685 X:19183777-19183799 CTGTCTCATGAAAAATTTAAAGG + Intergenic
1195942875 X:110179813-110179835 CTGGCACAGGACCCATTCCATGG + Intronic
1198316809 X:135476269-135476291 GTGGCAGATGACCCATTTCACGG - Intergenic
1198509943 X:137340484-137340506 CTGGCTCCTGACACATCTAAAGG - Intergenic
1199064542 X:143399508-143399530 TTGGATCTTGAACCATTTAATGG - Intergenic