ID: 1035875950

View in Genome Browser
Species Human (GRCh38)
Location 8:3189867-3189889
Sequence TGCCCGCCAGAACTCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035875950_1035875956 12 Left 1035875950 8:3189867-3189889 CCACCACAGAGTTCTGGCGGGCA 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1035875956 8:3189902-3189924 CACTGCTCACCCACACAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 181
1035875950_1035875957 13 Left 1035875950 8:3189867-3189889 CCACCACAGAGTTCTGGCGGGCA 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1035875957 8:3189903-3189925 ACTGCTCACCCACACAGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 212
1035875950_1035875955 11 Left 1035875950 8:3189867-3189889 CCACCACAGAGTTCTGGCGGGCA 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1035875955 8:3189901-3189923 ACACTGCTCACCCACACAGCTGG 0: 1
1: 0
2: 2
3: 55
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035875950 Original CRISPR TGCCCGCCAGAACTCTGTGG TGG (reversed) Intronic
900498471 1:2987803-2987825 TGCCCCACAGAGCTCTGCGGTGG + Intergenic
901680349 1:10909497-10909519 TGCCCTCTAGTACTCTCTGGGGG + Intergenic
902806857 1:18866337-18866359 TGCTCTCCAGAACTCCGTGAAGG + Intronic
903779275 1:25811065-25811087 TGCCCGCCAGAGGCCTGTGCAGG + Intronic
904379223 1:30100085-30100107 TAGGCGCCATAACTCTGTGGAGG - Intergenic
904412839 1:30335464-30335486 TGCCAGACAAAACTCTTTGGAGG - Intergenic
904613311 1:31736837-31736859 TGCCTGGCAGGGCTCTGTGGGGG - Intronic
907428614 1:54397280-54397302 TGCCTGCCAGAACCCTTTCGGGG - Intronic
907927142 1:58965605-58965627 TGCCCTCCACAACTCTGTGTGGG + Intergenic
908002589 1:59695196-59695218 GGCCCACCAGAACTCTGAGAGGG - Intronic
910380658 1:86623233-86623255 TTCTGGCCAGAACTCTGGGGAGG + Intergenic
914446073 1:147751602-147751624 TGACTGCCAGAACCCTGGGGTGG + Intergenic
923648157 1:235845482-235845504 TGCTGGCCAGAACTCCGGGGAGG + Intronic
924562567 1:245169362-245169384 TGCGCGCAAGCACTTTGTGGAGG + Intronic
1070161737 10:73870966-73870988 TGCCAGCCAGTACTGTGTGGAGG - Intronic
1076740834 10:132483737-132483759 TTCCCACCAGCAATCTGTGGGGG - Intergenic
1078222446 11:9363247-9363269 TGCCCTCCAGAGCTCTGGTGAGG - Intergenic
1080261027 11:30349845-30349867 TGCCCACCAGGTCTCAGTGGTGG - Intergenic
1087153884 11:94882616-94882638 TCCCCTCCAGAACACTGTGATGG - Intergenic
1087468791 11:98545659-98545681 TCCTGGCCAGAACTCTGGGGAGG + Intergenic
1089740782 11:120580836-120580858 TGCCAACCTGATCTCTGTGGTGG + Intronic
1090276607 11:125424495-125424517 TGCCAGCCACCACTCTGGGGTGG - Intronic
1090982699 11:131737538-131737560 TGCCCTCCAGAACTCAGCAGAGG + Intronic
1091816408 12:3442382-3442404 TGCCTCCCAGAACTCTGTGTAGG + Intronic
1092915990 12:13189414-13189436 TGCCCTGCAGAGCTCTGTGTGGG + Intergenic
1095761995 12:45850335-45850357 TGAACAACAGAACTCTGTGGAGG - Exonic
1096217116 12:49803869-49803891 TGCCAGCCAGAGCCCTGGGGAGG - Intronic
1099777478 12:87151664-87151686 TCCTGGCCAGAACTCTGGGGAGG - Intergenic
1100611038 12:96192768-96192790 TGCCCTCCAGACCTCTGAGAAGG - Intergenic
1101102312 12:101406887-101406909 TGCTCCCCAGAAAACTGTGGAGG + Intronic
1101789985 12:107917788-107917810 TGCCCTTCATAACTCTGTGAGGG + Intergenic
1102028615 12:109727373-109727395 TGTCGGCCAAACCTCTGTGGAGG - Intronic
1102367053 12:112346736-112346758 CCCCAGCCAGAACTCAGTGGTGG + Intronic
1103512546 12:121485132-121485154 TGGCCTCCAGAACTATGAGGCGG + Intronic
1103614373 12:122142852-122142874 TGGCAGGCAGCACTCTGTGGTGG + Exonic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1113775717 13:112943781-112943803 GGTCCGCCTGAAGTCTGTGGAGG - Intronic
1115489108 14:33941785-33941807 TGCTCCCCAGAACTCTGTCGTGG - Intronic
1116973622 14:51093900-51093922 TCCCCGCAACAACTCTGTGGGGG + Intronic
1122291039 14:100680597-100680619 TGCCGGCCAGCCCTCTGTGGTGG - Intergenic
1126102228 15:45125777-45125799 TGCTCCCCAGGAATCTGTGGTGG + Intronic
1129743977 15:78005241-78005263 TGTCCTCCAGAGCTCAGTGGAGG - Intronic
1130233787 15:82116090-82116112 TCCCCGCCAAAACTGTGTGAGGG + Intergenic
1132087069 15:98917133-98917155 TGCCCACCTGCTCTCTGTGGGGG - Intronic
1133025542 16:2987566-2987588 TGCCCCCCAACACTGTGTGGTGG + Intergenic
1134188016 16:12099569-12099591 TCCGGGCCAGAACGCTGTGGGGG - Intronic
1134299128 16:12974048-12974070 TGCCTGCCAGGATTCTTTGGTGG + Intronic
1138506131 16:57479224-57479246 TGCCAGCCAGCCCTCTGGGGCGG + Intronic
1140481096 16:75263306-75263328 TGCCAGCCAGAGGTCTGAGGTGG + Intronic
1141047096 16:80725099-80725121 TGCCCACCAAGGCTCTGTGGTGG - Intronic
1143280750 17:5752504-5752526 TGCTAGACAGAACTGTGTGGGGG + Intergenic
1144819981 17:18065701-18065723 TGCCCCCCAGAGCTCTGTGCAGG + Exonic
1145245752 17:21268347-21268369 TTCCTGCCAGAGCTCTGTGAGGG + Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149032719 17:52102222-52102244 GGCCGGCCAGAATTCTCTGGAGG - Intronic
1152179018 17:78806269-78806291 TGCAGGCCAGCACCCTGTGGAGG - Exonic
1152435045 17:80271386-80271408 TGCCCTCCAGATCTCAGAGGAGG + Intronic
1158829692 18:61263812-61263834 TCCCAGCCAGAACTCTGAGGAGG + Intergenic
1160414437 18:78698294-78698316 TGCCAGTCAGGACCCTGTGGTGG - Intergenic
1160893183 19:1390252-1390274 TGCCCGCCAGAAGCCTGTGTTGG - Intronic
1162489828 19:10985533-10985555 TGCCAGACAGCTCTCTGTGGCGG - Intronic
1163700072 19:18782505-18782527 TGCCCCCCAGAATCCTGGGGCGG + Intergenic
927093185 2:19727960-19727982 TGCCTGACAGACCTCAGTGGAGG - Intergenic
927887103 2:26725306-26725328 TGCCCGCCAGAGCCCTCTGCAGG - Intronic
936755308 2:115702232-115702254 TGCCCACCAGCACTCTCTGAGGG - Intronic
937980567 2:127612241-127612263 TTGCAGCCAGATCTCTGTGGAGG - Intronic
938610010 2:132937787-132937809 TGCCAGCCACAAATCTTTGGTGG - Intronic
938636284 2:133230218-133230240 TGCCCACCAGATGCCTGTGGTGG - Intronic
942430304 2:175904155-175904177 TGCCCTCCTGAACTCTTTGGGGG + Intergenic
942618975 2:177827075-177827097 TGCCTGCCAGATCTTTGTGGTGG - Intronic
948859041 2:240744048-240744070 TGCCCACCAGATCGCAGTGGAGG - Exonic
1169055883 20:2620651-2620673 GGCCTCCCAGAATTCTGTGGCGG + Intronic
1169981902 20:11394131-11394153 TGCACACCAGAACTATCTGGAGG - Intergenic
1174527338 20:51184128-51184150 TTCCAGCAACAACTCTGTGGGGG - Intergenic
1176163065 20:63658348-63658370 TGCCCGCGAAAACTCTGAGCTGG + Exonic
1177520235 21:22212001-22212023 TGCAACCCAGAACTCTGTGAAGG + Intergenic
1178958969 21:37047016-37047038 TCCCCGTCAGAACTCAGGGGAGG + Intergenic
1179817612 21:43917754-43917776 TCCCCGGCAGAACTGTGTTGGGG + Intronic
1181316353 22:21973128-21973150 TTCCACCCAGCACTCTGTGGGGG + Intronic
1181470181 22:23133991-23134013 TGCCCGACAGATCTGTGTGCAGG + Intronic
1185098533 22:48825178-48825200 TCCATGCCAGCACTCTGTGGGGG + Intronic
949645801 3:6092423-6092445 TGCCCTCCAGATCTCTTTGTTGG + Intergenic
951858178 3:27221654-27221676 TGCCCGGCAGACCTCATTGGGGG + Intronic
954430808 3:50470042-50470064 TGCCCCCCAGGTTTCTGTGGAGG - Intronic
954700337 3:52447602-52447624 TCCCAGCCAGAATTCTGGGGTGG + Intergenic
954746091 3:52788335-52788357 TGCCCGCCATACCTGTGTTGGGG - Exonic
955746509 3:62146047-62146069 TGGCCACCAGAACCCTGTAGGGG + Intronic
957946294 3:87067623-87067645 TGACTGCCAGGGCTCTGTGGTGG + Intergenic
959275291 3:104269972-104269994 TCCTGGCCAGAACTCAGTGGAGG - Intergenic
959530648 3:107431264-107431286 TCCCTGCCAGTACGCTGTGGCGG + Intergenic
963954208 3:151235204-151235226 TGCCTGGCAGAACTCTGAGCAGG + Intronic
977733161 4:100379642-100379664 TCCTGGCCAGAACTCTGGGGAGG + Intergenic
979665366 4:123305135-123305157 TGCCTGCCAGAAGTGTGGGGAGG + Intronic
984063377 4:175019722-175019744 CGCCCTCCAGAACTTTGTTGAGG + Intergenic
985117541 4:186606281-186606303 TGCCCGTCAGGACTCTCAGGAGG - Intronic
987795350 5:22620971-22620993 TGATCTCCAGAACTCTGTGAAGG - Intronic
989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG + Intronic
996599927 5:125251305-125251327 TGCCCTCCAGAACTGTCTGGGGG - Intergenic
997106048 5:131020073-131020095 TCCTGGCCAGAACTCTGGGGAGG - Intergenic
998212419 5:140210016-140210038 TGAAGGCCAGAACTCAGTGGAGG - Intronic
1000190714 5:158908036-158908058 TGTCTGCCAAAACTCGGTGGTGG - Intronic
1001936408 5:175708938-175708960 TGGCCCCCAGCACTCTCTGGTGG + Intergenic
1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG + Intronic
1003778162 6:9392498-9392520 AGCCCTGCACAACTCTGTGGAGG - Intergenic
1007278180 6:40690916-40690938 TGCCAGCCAGAAATCTGTCTTGG + Intergenic
1009600032 6:65787096-65787118 TGCCAGCCAGAAAGCTGTGTGGG - Intergenic
1009701204 6:67183922-67183944 TGCCCAATAGAACTCTGTGCAGG - Intergenic
1011298757 6:85852206-85852228 TGCAAGCCAGAACACAGTGGGGG - Intergenic
1017289897 6:152723722-152723744 TGCCCACTGGAACTCTCTGGTGG - Exonic
1019076795 6:169394375-169394397 TGACAGCTAGAACTCTGTGAAGG + Intergenic
1027935390 7:84595427-84595449 AGCTCGCTAGAACTTTGTGGAGG - Intergenic
1028019389 7:85750754-85750776 TGCCCGCCAGAGCGCTTTGTAGG - Intergenic
1029557373 7:101279735-101279757 TGCCTGGCACTACTCTGTGGGGG + Intergenic
1031401666 7:121330657-121330679 TGCCGGCCAGAACGCCGCGGGGG - Intronic
1035528479 8:332990-333012 TGGCCCCCAGAACTCTGAGAGGG + Intergenic
1035875950 8:3189867-3189889 TGCCCGCCAGAACTCTGTGGTGG - Intronic
1036145068 8:6247487-6247509 TGCCCTGGAGAACTCAGTGGAGG - Intergenic
1039583115 8:38682996-38683018 TGGAGGCCAGAACCCTGTGGAGG + Intergenic
1040566457 8:48571988-48572010 TGCCAGCCACAGCTCTCTGGGGG + Intergenic
1040800194 8:51331476-51331498 TCCTAGCCAGAACTCTGGGGAGG + Intronic
1053292839 9:36893362-36893384 TGGCATCCAGACCTCTGTGGTGG + Intronic
1056713657 9:89010975-89010997 TTCCCTCCAGCACTGTGTGGTGG - Intergenic
1062290853 9:135793741-135793763 TGCCCACTAGCCCTCTGTGGGGG + Intergenic
1194701556 X:97120038-97120060 TCCTGGCCAGAACTCAGTGGAGG - Intronic
1197700538 X:129596280-129596302 AGCCAGGCAGAACTCTGTGAGGG + Intergenic
1197760196 X:130022539-130022561 TGCCCAGCAGAACTTTGTTGAGG + Intronic
1200976428 Y:9216509-9216531 AGCCCACCAGAACTTTGTAGGGG - Intergenic
1201306642 Y:12556336-12556358 TCCTGGCCAGAACTCTGAGGAGG + Intergenic