ID: 1035876075

View in Genome Browser
Species Human (GRCh38)
Location 8:3191052-3191074
Sequence CACTGTGTTTATAGTTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035876072_1035876075 -3 Left 1035876072 8:3191032-3191054 CCTGGAGACCTGCTCTACAGCAC 0: 1
1: 0
2: 2
3: 19
4: 161
Right 1035876075 8:3191052-3191074 CACTGTGTTTATAGTTAAGAGGG No data
1035876071_1035876075 -2 Left 1035876071 8:3191031-3191053 CCCTGGAGACCTGCTCTACAGCA 0: 1
1: 1
2: 0
3: 20
4: 188
Right 1035876075 8:3191052-3191074 CACTGTGTTTATAGTTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035876075 Original CRISPR CACTGTGTTTATAGTTAAGA GGG Intronic
No off target data available for this crispr