ID: 1035876463

View in Genome Browser
Species Human (GRCh38)
Location 8:3195228-3195250
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035876459_1035876463 9 Left 1035876459 8:3195196-3195218 CCAACATGAAGGTTTACTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr