ID: 1035877201

View in Genome Browser
Species Human (GRCh38)
Location 8:3203906-3203928
Sequence TGTGCAATCCAGACACTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035877201_1035877206 9 Left 1035877201 8:3203906-3203928 CCCCGTAGTGTCTGGATTGCACA 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1035877206 8:3203938-3203960 CCCCTCACCATAAGCCTGCCAGG No data
1035877201_1035877208 10 Left 1035877201 8:3203906-3203928 CCCCGTAGTGTCTGGATTGCACA 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1035877208 8:3203939-3203961 CCCTCACCATAAGCCTGCCAGGG No data
1035877201_1035877211 16 Left 1035877201 8:3203906-3203928 CCCCGTAGTGTCTGGATTGCACA 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1035877211 8:3203945-3203967 CCATAAGCCTGCCAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035877201 Original CRISPR TGTGCAATCCAGACACTACG GGG (reversed) Intronic
901139986 1:7022402-7022424 TGTGCAATCAAGAGGCTATGAGG + Intronic
902877151 1:19347561-19347583 TGTGCACTGCATACACTATGTGG + Intronic
906546420 1:46622463-46622485 TGTGGAATCCAGACTCTACGGGG - Intergenic
910197410 1:84657872-84657894 CGTGTAATCCAGACACTCTGGGG + Intronic
921117852 1:212111328-212111350 TGTTGAAACCAGACACTATGGGG - Intergenic
922478370 1:225922245-225922267 CGTGCAAGCCAGACACATCGTGG - Exonic
924360229 1:243232643-243232665 TGCGGAATCCAGACACTCTGAGG + Intronic
1062790584 10:301844-301866 AGTGCAAACCAGACACCAGGAGG + Intronic
1071601876 10:86962430-86962452 CGTGCAATTCAGACAATACCCGG - Intronic
1075896633 10:126001809-126001831 TGGGCAATCCAGAGCCTCCGGGG + Intronic
1076933858 10:133554829-133554851 TGAGCAATCCAGAGACCAGGAGG + Exonic
1080548582 11:33347937-33347959 TGTGCAATCCCCACACTAACTGG - Exonic
1081694804 11:45102505-45102527 TCTGCAATCCAGCCACTCCCAGG + Intronic
1095245296 12:39912678-39912700 AGTGCCATCCAGAAACTACATGG + Intronic
1095503640 12:42868429-42868451 TGTGCAAACCAGACTCCAGGTGG - Intergenic
1102236672 12:111298261-111298283 TGGGCATTCCAGGCACTACCAGG + Intronic
1108824517 13:54396009-54396031 TGGGCAATGCAGGCACCACGAGG + Intergenic
1119171904 14:72541991-72542013 TGTGCACTTCAGACACTTAGGGG - Intronic
1121968640 14:98335566-98335588 TGTACAATCCATCCACTATGAGG - Intergenic
1127313577 15:57773861-57773883 TGGGCAAACAAGACACTACTTGG - Intronic
1130124577 15:81082388-81082410 TGTGCAATCTAGAAAGTACCTGG - Intronic
1133432598 16:5751159-5751181 TGTTCAATCCAGACAGTTTGAGG + Intergenic
1143235049 17:5392539-5392561 TGTGAAATCTACACACTACTGGG + Intronic
1145781623 17:27567557-27567579 TGTGCAATCCAGAAGCAATGCGG - Intronic
1151865100 17:76796544-76796566 AGTTCAATCCTGACACTACCAGG + Intergenic
1155453204 18:25984398-25984420 GGTGCAATCCAAACAATACTTGG - Intergenic
927688766 2:25192412-25192434 TGTTCAAGCCAGACACTTGGGGG - Intergenic
942067268 2:172283667-172283689 TGTGCAATCCAGATAGCAAGAGG + Intergenic
948932190 2:241139205-241139227 TGTGAAAGCCACACACTAGGTGG + Intronic
1171064531 20:22001397-22001419 TGTACAGTACAGACACTATGTGG + Intergenic
1177591906 21:23182037-23182059 TGTGCAGGCCAGACACTCCAAGG - Intergenic
1180786844 22:18552411-18552433 TGTGCCACCCAGAAACTCCGGGG + Intergenic
1181234894 22:21442897-21442919 TGTGCCACCCAGAAACTCCGGGG - Intronic
1181243755 22:21491932-21491954 TGTGCCACCCAGAAACTCCGGGG + Intergenic
959459684 3:106609894-106609916 TGTTTATTCCAGACACTAGGGGG - Intergenic
968638925 4:1700170-1700192 TATGCAATCCAGAAGCTCCGTGG + Intronic
970829375 4:20318843-20318865 AGTGGAATCCAAACACTAAGTGG - Intronic
973609591 4:52622808-52622830 TGTGCATTCCAGACAGAAAGTGG + Intronic
992392005 5:76338098-76338120 TTTGCAGTCCAGACACCAGGTGG + Intronic
997622045 5:135305360-135305382 TGTGCATGCCAGCCCCTACGTGG - Intronic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1000041483 5:157488127-157488149 TCTGCAATTCAGTCAATACGGGG - Intronic
1005646122 6:27839898-27839920 TGGCCAATCCCGACACTGCGAGG + Intronic
1006951500 6:37825125-37825147 TGTGAAGTCCACACACTATGAGG - Intronic
1007873580 6:45068740-45068762 TGTGAAGTCCACACACTATGAGG - Intronic
1016334085 6:142985085-142985107 TGAACAATCCAGACACAATGTGG - Intergenic
1026140106 7:67698486-67698508 TGTGTAACCCAGACCCTATGAGG - Intergenic
1034843212 7:154418917-154418939 TGTGCATTCCAGACCCTCCAGGG + Intronic
1035877201 8:3203906-3203928 TGTGCAATCCAGACACTACGGGG - Intronic
1061924273 9:133798295-133798317 TGTGGAATCCAGACACCATGTGG - Intronic
1199602092 X:149547267-149547289 TGTACAATCCAGAAACTAGCAGG - Exonic
1199648295 X:149932217-149932239 TGTACAATCCAGAAACTAGCAGG + Exonic