ID: 1035880245

View in Genome Browser
Species Human (GRCh38)
Location 8:3238734-3238756
Sequence CTCTAATTAGATGTCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035880245_1035880248 -9 Left 1035880245 8:3238734-3238756 CCACCCAGGACATCTAATTAGAG 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1035880248 8:3238748-3238770 TAATTAGAGAGTGCCTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035880245 Original CRISPR CTCTAATTAGATGTCCTGGG TGG (reversed) Intronic
903667246 1:25015599-25015621 CTCTCATGAGATGGCCTAGGAGG + Intergenic
903952482 1:27004439-27004461 CTCTAATCAGATCCCCTGGATGG - Intergenic
908786982 1:67744838-67744860 CTCTTAGGAGATGTGCTGGGAGG - Intronic
909273679 1:73657094-73657116 CTCTAATTATGTGTACTGGTGGG - Intergenic
910206089 1:84750296-84750318 CTCTAATAAAATGACCTGGAGGG + Intergenic
910528123 1:88204363-88204385 CTCAAAATAGCTGCCCTGGGAGG + Intergenic
916388533 1:164304807-164304829 TTCTTATTAGCTTTCCTGGGTGG + Intergenic
923314805 1:232769844-232769866 CTCCCATTAGAGCTCCTGGGTGG - Intergenic
1063637256 10:7794814-7794836 CTCTAATTGAATGACCTTGGTGG - Intronic
1063661884 10:8040040-8040062 CTCTAATTAGATCACAAGGGTGG - Intergenic
1067170797 10:43904372-43904394 CTGAATTTAAATGTCCTGGGTGG + Intergenic
1073275741 10:102309376-102309398 CTCTAATAAGATGGCCTTTGGGG + Intronic
1074266490 10:111909610-111909632 CTCTAGTTAGGTTTTCTGGGGGG - Intergenic
1078092037 11:8269763-8269785 CTCTCAATAGATTTCCTGGGAGG - Intergenic
1085384123 11:76146862-76146884 CTATAATTAGATGTGCTAAGGGG - Intergenic
1085531773 11:77196040-77196062 CACTAATGAGATATCTTGGGTGG - Intronic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1091860080 12:3773499-3773521 CTCTCTTTTGGTGTCCTGGGTGG + Intergenic
1096693831 12:53336428-53336450 CACTAATTAGAGATCCAGGGGGG + Intronic
1099588585 12:84555121-84555143 CTCTAATTATATGTGCCTGGGGG - Intergenic
1101617333 12:106351042-106351064 CTCTAATTGGATGACTTTGGTGG - Intergenic
1103300870 12:119925638-119925660 TTCTAAGTAGATGTCCTTGAAGG - Intergenic
1110147391 13:72208476-72208498 CTCTAATTAGCTTCCCTGGGAGG - Intergenic
1110776183 13:79410882-79410904 CTCTAATTAGATGGGCATGGTGG - Intergenic
1114568790 14:23651321-23651343 CTCTTATAAGAGGTCCTAGGGGG - Intergenic
1115631356 14:35249215-35249237 CTGGAATTAATTGTCCTGGGTGG - Intronic
1115879228 14:37896147-37896169 CTCTAATTAGATGAAATGGGAGG + Intronic
1116487435 14:45467424-45467446 CTCTAATGAGATGTCCTAGGAGG + Intergenic
1128404118 15:67317643-67317665 CTCTTGTTAGATCTCCTGGAAGG + Intronic
1128462245 15:67879457-67879479 CTCTAATGAGAGGTCTGGGGTGG + Intergenic
1130786341 15:87100699-87100721 CTCTAATAAGCTTTCCTGGTAGG + Intergenic
1134365515 16:13574049-13574071 CTGTTTTTAGATGGCCTGGGAGG - Intergenic
1140147191 16:72322580-72322602 CTCTGATTAGTTGTACTGGAAGG + Intergenic
1141307169 16:82876128-82876150 CACTATTTACATGTCATGGGAGG - Intronic
1141999472 16:87655955-87655977 CTCTGCATAGATGTCCTGAGTGG + Intronic
1144296786 17:13883947-13883969 CTCTAATCAGATGTTCTGTTTGG + Intergenic
1144413294 17:15022045-15022067 TTCTTATAAGATGTCCTGGCCGG + Intergenic
1149127743 17:53255395-53255417 ATCTTATTTGATGTCCTTGGGGG - Intergenic
1152056547 17:78032655-78032677 CTGTAATTAGATGTGCAAGGAGG + Intronic
1152853517 17:82650512-82650534 CTCTAAAGATGTGTCCTGGGGGG + Intergenic
1161415567 19:4144946-4144968 CTCTCCTCTGATGTCCTGGGTGG - Intergenic
1164811086 19:31156504-31156526 CTTTAAATAGATGCCCTGGGTGG - Intergenic
925036163 2:687826-687848 ATCAAAATAGAGGTCCTGGGAGG + Intergenic
926227967 2:10981918-10981940 CTTTAAGTAGATGTCGTAGGAGG - Intergenic
926868811 2:17390408-17390430 CCATAATCACATGTCCTGGGAGG + Intergenic
928785488 2:34880821-34880843 GTCTCATTAAATGACCTGGGTGG + Intergenic
934530866 2:95087728-95087750 CTCTAATAACCTGTCATGGGTGG + Intronic
936984061 2:118291284-118291306 CTCAGACCAGATGTCCTGGGAGG - Intergenic
940225075 2:151392700-151392722 CTCTAGTGAGCTGTCCTGGTTGG - Intergenic
940721319 2:157285534-157285556 CTCTTATTAGATGGCCATGGAGG - Intronic
940932734 2:159453787-159453809 TTCTGAATAAATGTCCTGGGAGG + Exonic
946211633 2:218151918-218151940 CTCTCATCTGATGTCCAGGGAGG - Intergenic
947469905 2:230391893-230391915 CTCTAAGTATATTTCCTGGTGGG - Intronic
1173537573 20:43827873-43827895 CTCTAATGAGCTTTCCTGGTAGG + Intergenic
1177133894 21:17290240-17290262 ATTTTATTAGATGTCCTTGGGGG - Intergenic
1177193391 21:17876605-17876627 CTCTTATTAGCTATCCTGGGGGG - Intergenic
1177784033 21:25650476-25650498 CTTTAGATAGCTGTCCTGGGTGG - Intronic
1179374713 21:40840317-40840339 CTTTGTTTTGATGTCCTGGGTGG + Intronic
952957582 3:38566559-38566581 CTCTAGGTAGATGTCCTCGAAGG + Exonic
957573387 3:81977866-81977888 TACTAATTAAATGTCCTTGGAGG + Intergenic
969387825 4:6867720-6867742 CTCTACATAGATGTGCCGGGTGG - Intronic
969601963 4:8182033-8182055 CTCCAATCAGATGACCTGGGCGG - Intergenic
970767184 4:19563783-19563805 CTCTGAGTAGATATCGTGGGTGG - Intergenic
972565969 4:40269369-40269391 CTCTAAGTGGATGTCTTTGGAGG - Intergenic
974841461 4:67304054-67304076 CTGTAATGAGAATTCCTGGGAGG + Intergenic
976497422 4:85746538-85746560 CTCTATTGTGATGTCCTTGGAGG + Intronic
978349561 4:107807564-107807586 CTCAATTTAGATATCCTGGTGGG - Intergenic
980978892 4:139636867-139636889 CATTAATTAAATGTACTGGGGGG - Intergenic
981045399 4:140260152-140260174 CTCTCATCATATGTCCTGTGTGG + Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981182130 4:141758194-141758216 CTCTAATCAGTGGTCCTGGAGGG + Intergenic
984393433 4:179167261-179167283 CTCTAATCAGATATCCTAAGTGG - Intergenic
986432279 5:7693110-7693132 CACTAATTTGATGTTGTGGGGGG - Intronic
989459806 5:41684249-41684271 ATCTGATTAGATGTCCTTGGAGG - Intergenic
992212173 5:74491660-74491682 CTCTCACTGGATGTCATGGGAGG - Intergenic
997262151 5:132473672-132473694 CTCTGACTAGCTGTCCTAGGTGG + Intronic
1001907099 5:175481839-175481861 CTATAATTCGATCTCCTGTGTGG + Intronic
1009703919 6:67220238-67220260 CTCAAATTGGGTGACCTGGGGGG - Intergenic
1012311733 6:97733722-97733744 CTCTGAGTACATGTCCTGAGAGG + Intergenic
1016416005 6:143834536-143834558 ATCTAATTAGATGCCATGGCTGG - Intronic
1017508455 6:155090593-155090615 CTTTAATTAGATATGCTGGATGG + Intronic
1018656761 6:166044186-166044208 AACTAACTACATGTCCTGGGAGG - Intergenic
1027899187 7:84087630-84087652 CTCTACTTAGATGTCCTCTAGGG - Intronic
1032738661 7:134716201-134716223 CTCTAAGTAGATGTACTCTGAGG + Intergenic
1035880245 8:3238734-3238756 CTCTAATTAGATGTCCTGGGTGG - Intronic
1036289195 8:7472368-7472390 CTCTAAATAGATGGCCTGTGAGG - Intronic
1036332286 8:7839159-7839181 CTCTAAATAGATGGCCTGTGAGG + Intronic
1036719192 8:11157020-11157042 CTCTAATTTGAGGTCATGAGAGG + Intronic
1039893981 8:41703272-41703294 ACATAATTAAATGTCCTGGGTGG - Intronic
1040705817 8:50125768-50125790 CTGTATTAAGATGTGCTGGGTGG + Intronic
1043550557 8:81367505-81367527 CTCTAATATGATGTCATGAGTGG - Intergenic
1059391523 9:114002340-114002362 CAGTGATGAGATGTCCTGGGAGG - Intronic
1060428679 9:123528208-123528230 CTCTAATTTAATGTCTTTGGAGG - Intronic
1187629604 X:21154308-21154330 CTTTCATTTGATGTTCTGGGAGG - Intergenic
1189397028 X:40632168-40632190 CTCTAATCAGATGTCCGTGATGG + Intronic
1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG + Intronic
1192158886 X:68768196-68768218 GTCTACTTAGATGGCCTGGAGGG - Intergenic
1195240752 X:102949685-102949707 CTCTACAGAGCTGTCCTGGGGGG - Intergenic
1196199667 X:112871411-112871433 CTCTACTGAGATGTCCTCTGGGG - Intergenic
1199355464 X:146857830-146857852 CTCAAATTAGATGTCTTTGCTGG + Intergenic