ID: 1035889751

View in Genome Browser
Species Human (GRCh38)
Location 8:3330522-3330544
Sequence ACTTCTAAGCAGGAGCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035889748_1035889751 -4 Left 1035889748 8:3330503-3330525 CCAAATACCGCGTGATCTCACTT 0: 2
1: 19
2: 494
3: 4706
4: 15062
Right 1035889751 8:3330522-3330544 ACTTCTAAGCAGGAGCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035889751 Original CRISPR ACTTCTAAGCAGGAGCTAAA TGG Intronic
No off target data available for this crispr