ID: 1035889956

View in Genome Browser
Species Human (GRCh38)
Location 8:3332442-3332464
Sequence AGCCTCACTGCAGCTCCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035889956_1035889960 -2 Left 1035889956 8:3332442-3332464 CCAACCGGAGCTGCAGTGAGGCT 0: 1
1: 0
2: 2
3: 16
4: 160
Right 1035889960 8:3332463-3332485 CTGATGCTTAGGGAAGATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035889956 Original CRISPR AGCCTCACTGCAGCTCCGGT TGG (reversed) Intronic
900504874 1:3024957-3024979 AGCCTCACTGCTGCTGCTGGGGG + Intergenic
902535788 1:17118795-17118817 AGCCTCAGGGCAGCTCCCTTCGG + Intronic
905921150 1:41719763-41719785 AACCTCACAGCAGCCCCAGTGGG + Intronic
908774228 1:67624983-67625005 AGCTTCCCTGCAGCTGGGGTTGG - Intergenic
909392764 1:75135436-75135458 GGCCTCAGTGCAGCTACGCTGGG + Intronic
913149930 1:116031491-116031513 AGTCTCCCTGCAGCTCCTGTTGG - Exonic
913531280 1:119735968-119735990 AGCCTCACACCAGATCCAGTAGG + Intronic
913531661 1:119738139-119738161 AGCCTCTCTGCAGCTTGTGTGGG + Intronic
915330342 1:155107804-155107826 ACCCACACTGCAGCTCCTGATGG - Intergenic
915429845 1:155857697-155857719 AGTCTCACTGTCGCTCAGGTTGG - Intronic
915621960 1:157091627-157091649 TGCCTCACTGCTGCTCTGCTTGG + Intergenic
915625563 1:157112080-157112102 AGCCTCTCTGGAGTTCGGGTCGG - Intergenic
915659295 1:157388972-157388994 ACCACCACTGCAGCTCCAGTAGG - Intergenic
916383280 1:164237443-164237465 ACCCTCACAGTAGCTCCGGGAGG + Intergenic
918467776 1:184838982-184839004 AGCCTCACTGCATCTCCCATAGG - Intronic
920195675 1:204224933-204224955 AGCCTCGCTGCATGTCCTGTGGG - Intronic
922445856 1:225696711-225696733 AGTCTCACTGCTGCCCAGGTTGG + Intergenic
924797234 1:247301098-247301120 GGCCTCGGTGCTGCTCCGGTGGG + Exonic
924814096 1:247427462-247427484 ACTCTCACTGAAGCCCCGGTAGG + Intronic
924814124 1:247427608-247427630 ACTCTCACTGAAGCCCCGGTAGG + Intronic
924814150 1:247427754-247427776 ACTCTCACTGAAGCCCCGGTAGG + Intronic
924814178 1:247427900-247427922 ACTCTCACTGAAGCCCCGGTAGG + Intronic
924814203 1:247428046-247428068 ACTCTCACTGAAGCCCCGGTAGG + Intronic
1065289420 10:24214996-24215018 AGCCGCACTGCAAGTCCGGCAGG - Intronic
1067064049 10:43093740-43093762 AGCCTCACTGCTGCTGCTGAGGG - Intronic
1069610659 10:69770410-69770432 AGCCTCACTGCTGCCCAGATTGG + Intergenic
1070326484 10:75392883-75392905 AGCCTCACTACAGCCCCATTAGG + Intergenic
1072742744 10:97919812-97919834 AGGCTCACTGCAGCTTCGACTGG + Intronic
1072753585 10:98001939-98001961 AGCATCACTGCTGCTCCAGGGGG - Intronic
1075975152 10:126688030-126688052 AGGCTCTCTGAAGTTCCGGTGGG - Intergenic
1075997463 10:126890205-126890227 AGACTCACTGCAGCTGGGGAAGG - Intergenic
1077182420 11:1222706-1222728 AGCCCCACTGCGGCTCCTGCTGG - Intergenic
1085224564 11:74907762-74907784 AGCCTCACTGCAGCCAGGGGTGG - Intronic
1087270894 11:96110449-96110471 AGCCTCTCTGCATTTCCTGTTGG - Intronic
1091994423 12:4982063-4982085 AACCTCACTGCAGCTCCCTCAGG - Intergenic
1092219756 12:6704964-6704986 AGCCCCACTGCACCTACTGTGGG + Intergenic
1094839255 12:34336091-34336113 AGCCTCACTGCCGCTTTGGACGG - Intergenic
1094842039 12:34346272-34346294 AGCCTCCCTGCAGCTTTGGGCGG + Intergenic
1096834647 12:54341935-54341957 AGCCTCACTGTAGGGCTGGTAGG + Intronic
1099229589 12:80006657-80006679 AGCATCACTTGAGCTCCGGGAGG - Intergenic
1100025438 12:90122319-90122341 AGCATCACTGCTGCTGGGGTGGG + Intergenic
1100488979 12:95059679-95059701 AGTCTCACTGTTGCTCCGGCTGG - Intronic
1102619281 12:114181169-114181191 ACCCTCCCTGCAGCCCTGGTGGG + Intergenic
1103298675 12:119909945-119909967 ATCCACACTGCTGCTCTGGTGGG + Intergenic
1103724145 12:122989575-122989597 GGCCTCACTCCAGCTCCGTGGGG + Intronic
1104025420 12:125022555-125022577 AGCCTCACTGTGTCTCAGGTTGG + Intronic
1104591086 12:130085187-130085209 ACCCGGACTGCAGCTCAGGTAGG - Intergenic
1107661408 13:42643216-42643238 ACCATCACTGCAGCTCCAGTTGG - Intergenic
1108352045 13:49596666-49596688 AGCCTCCCTGCAGCTGCAGCTGG - Intergenic
1112129585 13:96507178-96507200 AGCCACACTGCAGCCTCTGTTGG + Intronic
1113628351 13:111863185-111863207 AGCCTCACTCCAGCAGCGGCGGG - Intergenic
1113913050 13:113853377-113853399 ATCCTCACTGCAGCTCTGCGGGG - Intronic
1115649192 14:35390851-35390873 AGCCTCAAGGCAGCTCCCGTGGG + Intergenic
1117751011 14:58924034-58924056 AGAATCACTGCAGCTCCATTCGG + Intergenic
1121573811 14:94967153-94967175 GGGCTCCCTGCAGCTCCTGTGGG - Intergenic
1122110054 14:99493205-99493227 TGGCTCACTGCAGCCCAGGTTGG - Intronic
1122854183 14:104552264-104552286 ACCCTCACAGCAGCACCCGTGGG - Intronic
1122985288 14:105208963-105208985 AGCCTCAGTGAAGCCCCTGTGGG + Intergenic
1124964515 15:34423259-34423281 CGCCACCCTGCAGCTCCTGTTGG + Intronic
1124981135 15:34569485-34569507 CGCCACCCTGCAGCTCCTGTTGG + Intronic
1125723173 15:41854824-41854846 AGCCTCAATGCGGCTCCTCTGGG + Exonic
1127336260 15:57987851-57987873 AGCCTCACTGTCGCTCAGGCTGG - Intronic
1127702906 15:61518622-61518644 AGCCTTACTTCAGCACCTGTTGG + Intergenic
1128260083 15:66227267-66227289 ATCCTCACAGCAGCTCCAGGAGG - Intronic
1132013916 15:98299699-98299721 TGCCTCCCCGCAGCTCCGGCTGG - Intergenic
1133100750 16:3478033-3478055 AGTCTCACTGTCGCTCAGGTTGG - Intronic
1135510596 16:23079842-23079864 AGCCTCATTTCCCCTCCGGTAGG - Intronic
1136515978 16:30768516-30768538 AGCCTCACTTGAGCTCTGCTCGG - Exonic
1139215079 16:65120098-65120120 AGGCTCCCTGCAGCTAGGGTTGG + Intronic
1139638336 16:68273027-68273049 AGCCTCACTGAAGCAGAGGTAGG + Intronic
1140232808 16:73131875-73131897 AGCCTCACAACAGCTCCAGGAGG - Intronic
1143923088 17:10346427-10346449 AGCCTCCCTCCAGCTCCTCTGGG - Intronic
1148161579 17:45453297-45453319 AGCCTCACTCCACCTCCTGCTGG - Intronic
1149270136 17:54968552-54968574 ACCCTCTCTGCAGCCCTGGTTGG + Exonic
1151269153 17:72979662-72979684 AGCCTCCTTGCAGCTCAGCTGGG - Intronic
1157193348 18:45599608-45599630 AGCCACTCTGCACCTCCGGCAGG + Intronic
1157898440 18:51490600-51490622 AACCTCACTGCAGCTTCCGCTGG + Intergenic
1157988254 18:52464505-52464527 ATCCTCACTGCAGATCTGATGGG - Intronic
1160656700 19:276123-276145 AGCCTGGCTGCTGCTCAGGTGGG - Intergenic
1163662686 19:18588292-18588314 AGACTCACTGTGGCTCCGGCTGG + Intronic
1164308935 19:24029693-24029715 GGCCTCATTGTAGCTCCGGGTGG - Intergenic
1165099303 19:33429015-33429037 AGCCTCCCTGCAGCTAGGCTGGG + Intronic
1165613604 19:37178968-37178990 AGCCTCACTGAAGCTGAGGGTGG + Intronic
1167368663 19:49067778-49067800 ACCCTCCCTGCAGCTCAGGAAGG - Exonic
1167551253 19:50162583-50162605 AGCCTCACTGTCGCTCCGGCTGG - Intronic
1168017184 19:53582876-53582898 AGCCACTCTGTAGCTCAGGTTGG - Intergenic
1168645568 19:58056938-58056960 TGTCTCACTGCAGCTCGGGCAGG - Intergenic
925141531 2:1553142-1553164 AGACTCACTGCAGCCCCAGAGGG - Intergenic
925148870 2:1601072-1601094 AGCCTCAGGGCACCTCCGGGAGG - Intergenic
926357164 2:12051626-12051648 ATCCTCACAGCAGCTCTGCTAGG - Intergenic
926747493 2:16170988-16171010 AGCCTCACAGCTGCTCCGGGAGG + Intergenic
933992767 2:87645418-87645440 CGACTCACTGCAGCTCCAGCTGG - Intergenic
934658952 2:96132927-96132949 AGCCTCCCTGCAGCCCAGGCTGG - Intronic
934949634 2:98567482-98567504 AGCCTCACTGGAGCCCCAGCAGG + Intronic
935739964 2:106138685-106138707 AGTCCCACTGCTGCTCCGGAAGG + Intronic
936301089 2:111305423-111305445 CGACTCACTGCAGCTCCAGCTGG + Intergenic
938176370 2:129134844-129134866 AGCCTCACTGTAGCTATGCTGGG + Intergenic
938379031 2:130826335-130826357 AGCCTCACTGCAGCGACAGGAGG + Intergenic
938946743 2:136219327-136219349 AGCCTCTCGGCAGCCCCGGGTGG + Intergenic
941789353 2:169534487-169534509 AGTCTCACTGTCGCTCAGGTTGG + Intronic
944439429 2:199727272-199727294 GCCATCACTGCAGCTCCAGTGGG - Intergenic
945714099 2:213336511-213336533 ACCATCACTGCGGCTCCAGTTGG + Intronic
946753361 2:222916681-222916703 AGCCTCACTGCAACACTGATTGG - Intronic
947910044 2:233794730-233794752 AGCCTCACTGCAGCCTCCGAGGG - Intronic
1170163540 20:13340073-13340095 AGCCTCCTTGCAGCTTAGGTGGG + Intergenic
1171133603 20:22677407-22677429 CGCCTCTCTGCAGCTCCGGGTGG - Intergenic
1172444885 20:34987746-34987768 AGCCTCCCTGCACCTCCAGGTGG + Exonic
1172640749 20:36439177-36439199 ATCCTCACTGCAGCCCCAGCAGG + Intronic
1172975712 20:38904231-38904253 AGCCTCATTGCAGCTCCAATGGG + Intronic
1174347140 20:49938484-49938506 AGCATCACTGCAACTCTGGCTGG + Intronic
1175225708 20:57442698-57442720 TGCCCCTCTGCAGCTCAGGTGGG + Intergenic
1179057640 21:37950975-37950997 TGCCTCATTGCAGCTCAGCTGGG + Intergenic
1180072203 21:45442148-45442170 GGCCCCACAGCAGCTACGGTGGG - Intronic
1180867431 22:19127455-19127477 AGCCTCACTGTAGCTCAGCCAGG + Intergenic
1180875352 22:19172492-19172514 AGCCTCCCTTCTGCTCAGGTTGG - Intergenic
1181267794 22:21641353-21641375 AGCTTCACTCCAGATCCTGTGGG - Intergenic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
1183171489 22:36191601-36191623 AGCATTACTGCAGCTGGGGTAGG - Exonic
1184892793 22:47389855-47389877 ACCCTCCCAGCAGCTCCGGGAGG + Intergenic
954043894 3:47912305-47912327 AGCCTCCCAGCAGCTCAGGAGGG + Intronic
954444510 3:50539593-50539615 AGCCTCCCCGCAGGTCAGGTTGG - Intergenic
956157942 3:66317980-66318002 GCCATCACTGCAGCTCCAGTTGG - Intronic
962067430 3:131996559-131996581 ACCGTCACTGCTGCTCCGCTAGG - Intronic
965605738 3:170496243-170496265 AGCCTCAGCCCAGCTGCGGTTGG - Intronic
966652367 3:182315489-182315511 AGCATTACTGCAGCTCTAGTCGG - Intergenic
968052408 3:195664186-195664208 AGCCACACAGCAGCACCGATGGG - Intergenic
968301708 3:197621746-197621768 AGCCACACAGCAGCACCGATGGG + Intergenic
976527886 4:86115037-86115059 ACCATCACTGCAACTCCAGTTGG - Intronic
982691904 4:158557845-158557867 TGCTTCACTGGAGCTCCAGTAGG + Intronic
982948355 4:161656434-161656456 AGCATCACTGCAGCAACTGTGGG - Exonic
985498616 5:225983-226005 AGCCACACAGCAGCACCGATGGG - Exonic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986428052 5:7654305-7654327 AGCCTCACTGCAGCACAGGGAGG + Intronic
987633940 5:20514277-20514299 AGGCACACTGCAGCTCCTGGAGG + Intronic
989210540 5:38855053-38855075 AGTCTCACTGCTGCTCTGGCCGG - Intronic
992635301 5:78720608-78720630 ATCCTCATTGCAGCTCCTCTTGG + Intronic
993020437 5:82584831-82584853 AGCATCACTGCAGCTCCAGTTGG - Intergenic
998622097 5:143806214-143806236 AGCCTCTCTGCAGCTATGATCGG + Intergenic
999326163 5:150645015-150645037 AGCGTCACAGCAGCTCCACTGGG - Intronic
999755413 5:154660766-154660788 AGCCTCACTGTAGCCCAGGCGGG + Intergenic
1001172975 5:169438976-169438998 ACCCTCACTGCTCCTCTGGTAGG + Intergenic
1001229113 5:169970578-169970600 AGCCTCCCTGCAGCACAGATGGG - Intronic
1001744535 5:174081858-174081880 AGTCTCACTGCTGCTCAGGCTGG - Intronic
1002210721 5:177597380-177597402 AGTCTCACTGTAGCCCAGGTTGG - Intergenic
1006422846 6:33946084-33946106 AGCCTCACTGCACCTTCAATGGG + Intergenic
1008067021 6:47061040-47061062 AGCCTCCCTGCCGTTCCTGTGGG + Intergenic
1015368603 6:132425370-132425392 ACCATCACTGCAGCTCCAGTTGG - Intergenic
1015539269 6:134297890-134297912 AGCCTCACTCCGGCTGCGGTTGG + Intronic
1017699824 6:157058144-157058166 ACCCTCACTTCACCTCCAGTAGG + Intronic
1018802966 6:167237644-167237666 AGAGTCACAGCAGCTCCCGTGGG + Intergenic
1022115800 7:27259529-27259551 AGGCTCACTGCAGCCTTGGTTGG + Intergenic
1023115856 7:36861842-36861864 AGCCTCATTGCAGCTCCGCTTGG - Intronic
1025976887 7:66377117-66377139 TGCCTCACGGCAGCCCCGGCAGG - Intronic
1026665287 7:72336265-72336287 AGCCGCACCGCAGCCCAGGTGGG - Intronic
1032117240 7:129127383-129127405 AGCCTCACAGCATCTCCTCTTGG + Intergenic
1035685055 8:1517713-1517735 AGCCTCTCTGCAGTTACGCTTGG + Intronic
1035889956 8:3332442-3332464 AGCCTCACTGCAGCTCCGGTTGG - Intronic
1036777120 8:11621067-11621089 ACCATCACTGCAGCTCCTCTGGG + Intergenic
1039025407 8:33252885-33252907 ACCATCACTGCAGTTCCAGTTGG - Intergenic
1043092552 8:75924149-75924171 ACCATCATTGCGGCTCCGGTTGG + Intergenic
1047730424 8:127723473-127723495 ACCCTCGCTGCAGCTCTGGAGGG - Intergenic
1048983164 8:139714204-139714226 AGCCTCTCAGCAGGGCCGGTCGG - Intergenic
1049469325 8:142768454-142768476 TGCCTCACTGCTCTTCCGGTTGG - Intronic
1050294662 9:4193693-4193715 AGCCTCCCTCCAGCTCAGGTGGG - Intronic
1053472404 9:38356377-38356399 ACCCTCACTGCAGCTCCATGAGG + Intergenic
1058807432 9:108605826-108605848 AGCCTCACTGAATCTCCCTTTGG + Intergenic
1060137322 9:121170004-121170026 AGCCTCAATGGAGCTCTGGCTGG + Intronic
1062353186 9:136149020-136149042 AGCCTCGCTGCACCTCCAGGAGG + Intergenic
1186875864 X:13817193-13817215 AGTCTCAATGCGGCTCCAGTGGG + Exonic
1188099950 X:26071395-26071417 ACCATCACTGCAGCTCCAGTGGG - Intergenic
1188611410 X:32103002-32103024 AACCTAAATGCAGCTCCGTTGGG - Intronic
1189893821 X:45632898-45632920 AGCCTCAGCCCAGCTGCGGTTGG + Intergenic
1190276008 X:48899748-48899770 ATCCTCACTGCAACTACGCTTGG - Intronic
1190971773 X:55356767-55356789 ACAATCACTGCAGCTCCAGTAGG + Intergenic
1191594094 X:62923238-62923260 ACCATCACTGCAGCTCCAGTCGG + Intergenic
1192191555 X:68994320-68994342 ACCCTCACTGCAGCTTTGGGGGG - Intergenic
1193895534 X:87110398-87110420 ACCATCACTGCAGCTCCAGTTGG + Intergenic
1194444975 X:93976035-93976057 GCCATCACTGCAGCTCCAGTTGG - Intergenic