ID: 1035889977

View in Genome Browser
Species Human (GRCh38)
Location 8:3332758-3332780
Sequence TCTGACGGGCAGATGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035889974_1035889977 -9 Left 1035889974 8:3332744-3332766 CCTAAATAGGAAACTCTGACGGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1035889977 8:3332758-3332780 TCTGACGGGCAGATGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035889977 Original CRISPR TCTGACGGGCAGATGTTGCA GGG Intronic
No off target data available for this crispr