ID: 1035891299

View in Genome Browser
Species Human (GRCh38)
Location 8:3346498-3346520
Sequence ATCTCACACTGGCAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035891299 Original CRISPR ATCTCACACTGGCAGTATGA GGG (reversed) Intronic
904254720 1:29247696-29247718 CTGCCACACTGGCAGTATGAGGG - Intronic
905101939 1:35531570-35531592 ATCTCCCTCTGCCAGTATCAGGG + Intronic
916169421 1:161989469-161989491 ATCTCAAGCTGGCAGCCTGAGGG - Intronic
917633049 1:176908661-176908683 ATCTCACACTGTTATTCTGAAGG + Intronic
921357686 1:214302018-214302040 CTGCCACACTGGCAGTAAGAGGG - Intronic
924487207 1:244496837-244496859 ATCTCACACTTTAAATATGAAGG - Intronic
1062779811 10:192364-192386 CTGTAACACTGGCAGCATGATGG - Intronic
1063973322 10:11396554-11396576 ATTTCCCACTTGCAGAATGAGGG + Intergenic
1066232201 10:33447062-33447084 ATTTCCCACTGGCAGAATGGTGG - Intergenic
1067988179 10:51176768-51176790 CTCTAACACTTGGAGTATGATGG + Intronic
1072900316 10:99401382-99401404 ACTTCACACTGGCACTGTGATGG + Intronic
1075535294 10:123266594-123266616 CTGTCACATTGGCAGTATTAAGG - Intergenic
1076035068 10:127193279-127193301 ACCTCACACTCCCAGAATGACGG + Intronic
1077048878 11:557883-557905 ATCCCAGACTGGCAGTGTGGAGG - Exonic
1077513135 11:2982392-2982414 ATCTAACACTGTCAGTTTAATGG + Intronic
1077726776 11:4682746-4682768 AGGTCACACTGGCAGTCTGCAGG + Exonic
1078152508 11:8771361-8771383 ATCTCACACTACCAGCATGCAGG + Intronic
1082691301 11:56308059-56308081 TTCTCATGCTGGCAGTATGATGG + Intergenic
1084590305 11:70086349-70086371 TTCCCACAGTGGCAGTGTGATGG - Intronic
1084831607 11:71774106-71774128 ATCTCACAGTGGCATGATCATGG - Intergenic
1086882015 11:92160511-92160533 AACTCAGAATGTCAGTATGAGGG - Intergenic
1089079335 11:115762820-115762842 ATCTCACACATGGAGTAGGATGG + Intergenic
1091389672 12:118344-118366 ATCTCAGACGGGCAGAATAAAGG - Intronic
1095911770 12:47434379-47434401 ATATCACATTGACAGAATGAAGG + Intergenic
1098841428 12:75482767-75482789 ACCTCACATTTGCAGCATGATGG + Intronic
1101366909 12:104080801-104080823 CTATAACACTGGCTGTATGAAGG - Exonic
1102488953 12:113277252-113277274 ATCTCCTACAGGCAGTTTGAAGG + Exonic
1104014026 12:124950487-124950509 TTGTCAAACTGGCAGTAAGAGGG + Exonic
1106136011 13:26974309-26974331 ATCTCTCACTGGGACCATGAAGG - Intergenic
1106603202 13:31204688-31204710 AACTCACTCTGGCTGTCTGATGG + Intronic
1106615836 13:31326672-31326694 ATCCCAAACAGGCAGGATGAGGG - Intronic
1110069555 13:71156766-71156788 ATCTCACACTAGCAGTTGGCTGG - Intergenic
1110684843 13:78359654-78359676 ATATCAAACTATCAGTATGAAGG + Intergenic
1112180451 13:97073730-97073752 ATCTCAGGCTGGTAGTATGATGG + Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1117496831 14:56313803-56313825 TTCTTAAACTGGCAGTATGCAGG - Intergenic
1120489593 14:85160692-85160714 ATCTCAGACTGTGAGTATGCTGG + Intergenic
1123721360 15:23064466-23064488 CTCTCACACTGGCAGCAGCATGG - Intergenic
1134761422 16:16718346-16718368 ATCTGACACTGTCAGTCAGAGGG - Intergenic
1134984637 16:18640824-18640846 ATCTGACACTGTCAGTCAGAGGG + Intergenic
1138647209 16:58434238-58434260 ATCTCACACTGACAGCCTGCTGG - Intergenic
1139102013 16:63779140-63779162 ATATCACACTGGTAGGCTGAAGG + Intergenic
1141008050 16:80371611-80371633 ATTTCACTGTGGCAGCATGATGG - Intergenic
1144334896 17:14259758-14259780 GTCTCACACTGGCAGTGACATGG + Intergenic
1146275983 17:31515907-31515929 ATCACACACTGTCATTATGCTGG + Intronic
1148618215 17:49015452-49015474 TTCTCAGACTGGCAGTGGGAAGG - Intronic
1155350082 18:24897617-24897639 ACCTCAACCTGGCAGTAGGAAGG + Intergenic
1156159392 18:34341732-34341754 GTCCCACACTGGCAGCAAGATGG - Intergenic
1156450894 18:37266043-37266065 CTCACACACTGGCAGCAGGATGG - Intronic
1157911873 18:51624075-51624097 GTCTCACAATGGCAGTTTGGGGG - Intergenic
1159140286 18:64386198-64386220 ACCTCACCCTGGAAGTATGTTGG + Intergenic
1159153277 18:64548468-64548490 ATATCACATTAGCAGAATGAAGG - Intergenic
1160094447 18:75858948-75858970 ATCTCACACTGACATTGTAATGG + Intergenic
1165237386 19:34433096-34433118 ATCTCAAACTGGCAGAAAGATGG - Intronic
1166247659 19:41540514-41540536 TTCTCATACTGGCAGTGTGTAGG - Intergenic
925010262 2:479621-479643 GTCTCACACTTCCAGTATCAAGG + Intergenic
925897263 2:8482307-8482329 ATCCCACACTGGCACCATCAGGG - Intergenic
927430633 2:23023606-23023628 ATCCCACTCTGGCAACATGAGGG - Intergenic
928265645 2:29809335-29809357 ATTTCAAACTCTCAGTATGATGG - Intronic
936396230 2:112133801-112133823 AGTTCACACTGGCAGCAAGAAGG + Intergenic
936832799 2:116669531-116669553 ATCTCTCACTGGGAGTCTGTGGG - Intergenic
937869800 2:126778776-126778798 CCCTAACACTGTCAGTATGAGGG - Intergenic
938276942 2:130035155-130035177 ATCTCCCACTAGCTGTAGGATGG - Intergenic
942062962 2:172244749-172244771 ATCTCACACTGCCAAGTTGAAGG - Intergenic
943152422 2:184131253-184131275 AACTGACAGTGGCAGTAAGATGG + Intergenic
944386634 2:199172262-199172284 AGCTCAGTCTGGCAGTAGGATGG + Intergenic
945358610 2:208868248-208868270 ATCTCACACTGGCAGTAAAGAGG + Intergenic
947239172 2:227975862-227975884 ATCAGAAACTGGCAGAATGAAGG + Intergenic
947571013 2:231234396-231234418 TTATCAAACTGGCAGAATGATGG + Intronic
1174334157 20:49845804-49845826 ATCTCACACTGGGAGTTGCAAGG - Intronic
1178694371 21:34780460-34780482 ATCTCACAATGGCAGCACTATGG + Intergenic
1180758797 22:18183160-18183182 ATCGGACCCTGGCAGTCTGACGG - Intergenic
1180777228 22:18495444-18495466 ATCGGACCCTGGCAGTCTGACGG + Intergenic
1180826959 22:18870180-18870202 ATCGGACCCTGGCAGTCTGACGG - Intergenic
1180914065 22:19473085-19473107 CTCTCACACTGGCAGTAAAGGGG + Intronic
1181096234 22:20507103-20507125 ATCTCACAATGGCTGTATTTGGG - Intronic
1181196091 22:21187005-21187027 ATCGGACCCTGGCAGTCTGACGG + Intergenic
1181213436 22:21306119-21306141 ATCGGACCCTGGCAGTCTGACGG - Intergenic
1181524131 22:23469428-23469450 ATCGGACCCTGGCAGTTTGACGG - Intergenic
1182627613 22:31659560-31659582 ATCTGAAATTGGCAGTAGGATGG + Intronic
1183546396 22:38456346-38456368 ACCTCACTCTGGGAGTCTGAGGG + Intergenic
1203230707 22_KI270731v1_random:107836-107858 ATCGGACCCTGGCAGTCTGACGG - Intergenic
1203277101 22_KI270734v1_random:96085-96107 ATCGGACCCTGGCAGTCTGACGG - Intergenic
956616290 3:71176179-71176201 GTCACACACTGACAGGATGAGGG - Intronic
956844682 3:73171673-73171695 ATCTCACACTTGCAGAAAAAAGG - Intergenic
959150131 3:102598194-102598216 ACCTGAGACTGGAAGTATGATGG - Intergenic
960295312 3:115935687-115935709 ATCTCAGAGTGGCAGGATGGGGG + Intronic
960934750 3:122891408-122891430 ATTTCACCCTGGCAGTCAGAGGG - Intergenic
961531798 3:127544570-127544592 AGCACACAGTGGCAGTGTGAGGG - Intergenic
967205831 3:187120322-187120344 TTTTCACACTGGCTGTATTATGG - Intergenic
967674667 3:192282456-192282478 ATCTCATAGTGGGAGTATGGAGG - Intronic
970957079 4:21825459-21825481 ATCTTACACAAGCATTATGATGG - Intronic
972230873 4:37071491-37071513 ATCTTTCACTGGCAGAAAGATGG - Intergenic
972477446 4:39464398-39464420 ATCTCAAACTGGAGGTATGAGGG - Intronic
982618349 4:157671608-157671630 TTCTCACAGTGCCAGGATGAAGG - Intergenic
982847328 4:160270597-160270619 ACCTCACACAGGTAGTGTGATGG + Intergenic
993821525 5:92623366-92623388 ATCTCTCACTTGGATTATGATGG - Intergenic
994443383 5:99839073-99839095 ATCTCTCACTGGCATCAAGAAGG - Intergenic
998898877 5:146830969-146830991 ATTGCACTCTGGCATTATGATGG - Intronic
1001680990 5:173556779-173556801 ATCTCACAGTGGCCAGATGAAGG - Intergenic
1004422679 6:15486082-15486104 AACTCCCTCTGGCAGGATGATGG + Intronic
1005749465 6:28869652-28869674 TTCTCCCACTGGCACTATTAGGG + Intergenic
1011247964 6:85339987-85340009 TTCTCAATCTGGCTGTATGATGG - Intergenic
1013792051 6:113848435-113848457 TTCTCACAGTGGCACTGTGAAGG + Intergenic
1016620864 6:146108070-146108092 ATTTCACACTGTCAATGTGAAGG - Intronic
1017031471 6:150226974-150226996 TTCTCATATTGGCAGTAAGAAGG + Intronic
1018068778 6:160142680-160142702 ATCTCACTCAGCCAGTGTGAGGG - Intronic
1018614959 6:165678483-165678505 ATTTCAAACTGGAAGTGTGAAGG + Intronic
1020752673 7:12162565-12162587 GTCAAACAATGGCAGTATGATGG - Intergenic
1024831665 7:53466598-53466620 AGGTCACACTGGCAGCATCATGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1035136361 7:156707587-156707609 ATATCACACTGACAGAATTAAGG + Intronic
1035891299 8:3346498-3346520 ATCTCACACTGGCAGTATGAGGG - Intronic
1036378119 8:8218264-8218286 ATCTCACAGTGGCATGATCATGG - Intergenic
1040820901 8:51555882-51555904 ATTTCACACTGAAATTATGATGG + Intronic
1040899040 8:52398719-52398741 ACATCACATTGGCAGAATGAAGG - Intronic
1045191034 8:99883884-99883906 ATACCACACTGACAGAATGAAGG + Intronic
1048670657 8:136715585-136715607 ATCTCATTCTGCCACTATGAGGG + Intergenic
1049787260 8:144456905-144456927 ACATCACACTGGCATCATGAGGG + Intronic
1052855025 9:33401801-33401823 ATCTCTAACTGACAGCATGAAGG + Intronic
1053933027 9:43126458-43126480 ATCTCTAACTGACAGCATGAAGG + Intergenic
1054296144 9:63333640-63333662 ATCTCTAACTGACAGCATGAAGG + Intergenic
1054394160 9:64638145-64638167 ATCTCTAACTGACAGCATGAAGG + Intergenic
1054428810 9:65143344-65143366 ATCTCTAACTGACAGCATGAAGG + Intergenic
1054811885 9:69441635-69441657 ATCTCTAACTGGCAGAAAGAAGG - Intronic
1058053472 9:100427835-100427857 ATCCCTCACTTGCAGGATGAAGG + Intronic
1059424700 9:114213431-114213453 ATCTCACACAGGCAGGATAATGG - Intronic
1061657299 9:132102367-132102389 ATTTTACACTGGCACTCTGAAGG - Intergenic
1190492168 X:50993160-50993182 AGCTCACTCTGACAGGATGAGGG - Intergenic
1190500934 X:51077988-51078010 AGCTCACTCTGACAGGATGAGGG + Intergenic
1196803013 X:119560370-119560392 TTCTCTAACTGGCAGTCTGAAGG + Exonic