ID: 1035897443

View in Genome Browser
Species Human (GRCh38)
Location 8:3419598-3419620
Sequence GGTTACGAATCTATAGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035897443_1035897448 13 Left 1035897443 8:3419598-3419620 CCAATTGCTATAGATTCGTAACC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1035897448 8:3419634-3419656 GGATTGAGAAGCAAATAAATAGG No data
1035897443_1035897449 26 Left 1035897443 8:3419598-3419620 CCAATTGCTATAGATTCGTAACC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1035897449 8:3419647-3419669 AATAAATAGGAAAAAAAAAGTGG No data
1035897443_1035897444 -8 Left 1035897443 8:3419598-3419620 CCAATTGCTATAGATTCGTAACC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1035897444 8:3419613-3419635 TCGTAACCCCTTTTATCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035897443 Original CRISPR GGTTACGAATCTATAGCAAT TGG (reversed) Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
921462374 1:215444592-215444614 GGTTAGGAATCTGTTGCAGTGGG + Intergenic
1067465210 10:46492693-46492715 GGTTAAGTAAATATAGCAATGGG + Intergenic
1067621977 10:47891908-47891930 GGTTAAGTAAATATAGCAATGGG - Intergenic
1068782942 10:60941762-60941784 TGTTACCAATCTATAGTCATGGG + Intronic
1077618650 11:3698757-3698779 GGTTCCTATTCTATAGGAATAGG + Intronic
1079694752 11:23466793-23466815 GGTTAAGAATCCATAGCCACAGG - Intergenic
1084615960 11:70236128-70236150 GGTTACGGATGTAAAGCAACTGG + Intergenic
1095161354 12:38919819-38919841 GGTCACATATCTATAGCAAGTGG + Intergenic
1095475490 12:42583271-42583293 GGTTTTGTCTCTATAGCAATGGG + Intronic
1105407348 13:20143284-20143306 GGTTAGGAATCTGAAGCAATGGG - Exonic
1107072411 13:36285664-36285686 GGTTACGACTGTATACTAATAGG - Intronic
1108959322 13:56203778-56203800 AGGTAAGAATCTATACCAATTGG - Intergenic
1116076918 14:40122475-40122497 GCTTAAAAACCTATAGCAATAGG + Intergenic
1121970629 14:98352818-98352840 GGCTACGGATTAATAGCAATTGG + Intergenic
1149072759 17:52562740-52562762 GGTTTGGAAACTATAGGAATGGG - Intergenic
1158207122 18:55005633-55005655 GGATCAGAATCTAGAGCAATGGG + Intergenic
929366021 2:41157610-41157632 GGTTACAAATCTATTACAACCGG - Intergenic
937575867 2:123421403-123421425 GTTTAGGAAGCTATAGCAACAGG + Intergenic
1182756888 22:32687556-32687578 AGTTAGGAAGCTATTGCAATGGG - Intronic
960446118 3:117750938-117750960 GGTTATGACCCCATAGCAATAGG - Intergenic
969130396 4:4986879-4986901 GGTTTCCAATCTATAGAAATTGG - Intergenic
970734089 4:19145227-19145249 GGCTACAAAGCTATAGCTATGGG + Intergenic
981616854 4:146651502-146651524 GTTTAGGATTCTACAGCAATGGG - Intergenic
983234205 4:165160524-165160546 GGTTACTAATTTACACCAATTGG - Intronic
984816799 4:183845774-183845796 AGTTACAAATCTATGTCAATGGG - Intergenic
993793842 5:92241492-92241514 AATTATGAAGCTATAGCAATAGG + Intergenic
1004237411 6:13886534-13886556 GATTACCACTCTGTAGCAATAGG - Intergenic
1008306134 6:49902408-49902430 GGTTAAGATTATATTGCAATGGG - Intergenic
1013402906 6:109816045-109816067 GGATTAGAATCTCTAGCAATGGG - Intronic
1026353717 7:69539519-69539541 TGTAAAGAATCTAGAGCAATAGG + Intergenic
1027676649 7:81167439-81167461 GGTGAAGAATCTATAGCTATGGG + Intergenic
1031226952 7:119051425-119051447 GTTTACCCATTTATAGCAATTGG - Intergenic
1032233322 7:130096469-130096491 GGTTAAGAAGATAAAGCAATGGG - Intronic
1035897443 8:3419598-3419620 GGTTACGAATCTATAGCAATTGG - Intronic
1036019056 8:4821775-4821797 TGTTACAACTCTCTAGCAATTGG + Intronic
1038738581 8:30195998-30196020 AATTATGAATCTATAGGAATGGG + Intergenic
1038987263 8:32825595-32825617 GGTAATGGAGCTATAGCAATTGG - Intergenic
1043784902 8:84386652-84386674 GGTAACCAATATATAGCACTTGG - Intronic
1046039459 8:108884734-108884756 TGTTAGGCAACTATAGCAATAGG - Intergenic
1047168651 8:122467520-122467542 GGTTAGGAATCCACTGCAATGGG - Intergenic
1187546917 X:20264539-20264561 GTTTCCTAATCTATAACAATGGG + Intronic
1188135862 X:26494176-26494198 GGTTAAGAATATAGAGCAAGAGG + Intergenic
1192684569 X:73289683-73289705 GGTTAGGAATCTACTGCACTGGG - Intergenic
1195567763 X:106362927-106362949 GGTTAGGAATCTACTGCACTAGG + Intergenic