ID: 1035897811

View in Genome Browser
Species Human (GRCh38)
Location 8:3423702-3423724
Sequence ACATTTCCACACAAAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035897811_1035897815 7 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897815 8:3423732-3423754 TTTCACTCGGGTGAACACTTAGG No data
1035897811_1035897814 -5 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897814 8:3423720-3423742 AATGTGTTTTTATTTCACTCGGG No data
1035897811_1035897817 9 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897817 8:3423734-3423756 TCACTCGGGTGAACACTTAGGGG No data
1035897811_1035897813 -6 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897813 8:3423719-3423741 AAATGTGTTTTTATTTCACTCGG No data
1035897811_1035897818 12 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897818 8:3423737-3423759 CTCGGGTGAACACTTAGGGGTGG No data
1035897811_1035897819 21 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897819 8:3423746-3423768 ACACTTAGGGGTGGAATTGTTGG No data
1035897811_1035897816 8 Left 1035897811 8:3423702-3423724 CCCAGGTCTTTGTGTGGAAATGT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1035897816 8:3423733-3423755 TTCACTCGGGTGAACACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035897811 Original CRISPR ACATTTCCACACAAAGACCT GGG (reversed) Intronic
900924695 1:5697350-5697372 ACATTTTCACAAACAAACCTGGG + Intergenic
904312998 1:29641507-29641529 ACATGTCCACCCACAGACCCTGG + Intergenic
905001022 1:34669767-34669789 TTATGTCCACACAAAAACCTGGG - Intergenic
905505556 1:38476501-38476523 AAATTTGCACACAAAGACCCGGG + Intergenic
906865176 1:49410407-49410429 ACATTTCCCCTCAAACACCTAGG - Intronic
910878173 1:91897428-91897450 ACTGTGCCACACAAAGGCCTTGG - Intronic
911516076 1:98869719-98869741 ACATTTTCACAAAAAGACCAAGG + Intergenic
912954292 1:114143684-114143706 TCATTTGTACACAAATACCTTGG - Intronic
916871938 1:168924950-168924972 ACATTTTCAGAAAAAGGCCTGGG - Intergenic
917201893 1:172525969-172525991 AAATGAACACACAAAGACCTAGG - Intergenic
917264003 1:173200324-173200346 TCATTTCTTCACTAAGACCTTGG - Intronic
917434195 1:175002096-175002118 ACACATCCACACAAAAAACTTGG - Intronic
917617508 1:176761137-176761159 ACATTGCAACACAATGACATTGG + Intronic
918647370 1:186919533-186919555 AAATTTCCTGCCAAAGACCTAGG - Intronic
918769126 1:188530846-188530868 ACATATCCACTCCAAGAGCTAGG + Intergenic
919940786 1:202284636-202284658 ACATTTCCAAACACTGACCTAGG - Intronic
922325302 1:224522903-224522925 ACATACGCACACATAGACCTAGG - Intronic
922915797 1:229256635-229256657 ACATTTCCACTCACAGACCCTGG + Intergenic
923042825 1:230332102-230332124 AAATCTGCACACAAACACCTGGG + Intronic
923479760 1:234373293-234373315 AAACTTCCACACAAACTCCTCGG + Intergenic
923838075 1:237636703-237636725 ATATGTCCACACAAAGACTTGGG + Intronic
924014487 1:239705582-239705604 ACATTTGGACACAGAGACATGGG - Intronic
1064308626 10:14190905-14190927 AAATTTGCACACAAAGCCCCAGG - Intronic
1065196536 10:23271386-23271408 ACATGTTCACACAAAGTCTTGGG - Intronic
1066987261 10:42478859-42478881 AGATGTGCACACACAGACCTGGG + Intergenic
1068453503 10:57224712-57224734 ACATTTCAAAAGAAAGTCCTTGG - Intergenic
1068462608 10:57347168-57347190 CCATTGCCACAAAAATACCTAGG - Intergenic
1068921329 10:62487853-62487875 ATATTGATACACAAAGACCTAGG - Intronic
1068961047 10:62866944-62866966 AAATTTCCAGATAAAGACATTGG - Intronic
1069079542 10:64073503-64073525 ACATCTCCACACAAAGTCTACGG - Intergenic
1069549996 10:69357212-69357234 ACGTGTCCACACAAAAACTTGGG + Intronic
1070108520 10:73460127-73460149 ACCTGTCAACACAAAGTCCTTGG - Intronic
1074698953 10:116076363-116076385 AAATTTCCACAGAAACACCCTGG + Intronic
1075024174 10:118971755-118971777 ACATGTCCACACAAAGTGATAGG + Intergenic
1075194342 10:120341990-120342012 ACATTTTCACACACAAACATCGG - Intergenic
1075332472 10:121583811-121583833 ACACATTCACCCAAAGACCTGGG + Intronic
1075726646 10:124613946-124613968 ACCTTTGCAGACAAAGACCAGGG + Exonic
1076088173 10:127654223-127654245 AAATGTCTACACTAAGACCTGGG + Intergenic
1077269444 11:1668338-1668360 ACATTTCTGCACAAGAACCTAGG - Intergenic
1078031264 11:7753779-7753801 CCATTTCCAAACAAACCCCTAGG + Intergenic
1078298850 11:10104402-10104424 AGATTTCCAGACAAAGAAGTGGG - Intronic
1078539492 11:12201669-12201691 ATACTTCCCCACAATGACCTAGG - Intronic
1083766252 11:64842984-64843006 CCAGCTCCACACACAGACCTGGG - Intronic
1083776920 11:64898523-64898545 GCATTCCCACACAAACACCCAGG - Intronic
1085700177 11:78738878-78738900 ACACATCCACACACAGAACTAGG - Intronic
1085975015 11:81642333-81642355 ACCTTTCCTCACAATGACATGGG + Intergenic
1088659622 11:112032734-112032756 TCATTTTCACAAAATGACCTTGG - Intronic
1090192469 11:124783181-124783203 ACAGTTCCCCACAAAGACTGAGG - Intronic
1090875854 11:130788303-130788325 ATATTTCCAGACATAGCCCTGGG + Intergenic
1091068659 11:132542391-132542413 ACATTTCCCCTCAAAGATTTAGG - Intronic
1092145585 12:6212469-6212491 ACATTTACACACAACGAGCCAGG + Intronic
1098714315 12:73810465-73810487 ACAAGTCCACAGAAATACCTGGG - Intergenic
1099748725 12:86743230-86743252 GCATTTCTTCACAAAGAACTAGG + Intronic
1101220963 12:102640134-102640156 ACAACTCCAGACATAGACCTTGG + Intergenic
1101661447 12:106769220-106769242 ACATTGCCACCCAAAGCGCTGGG + Intronic
1101742940 12:107515241-107515263 ACATTTTAAAACAAAGATCTGGG + Intronic
1102679785 12:114683614-114683636 ACATTTGCAACAAAAGACCTAGG - Intronic
1105410647 13:20168551-20168573 TCATGTCCACACAGGGACCTGGG - Intergenic
1105933940 13:25081043-25081065 CTATTTCCACGCAAAGACATTGG + Intergenic
1107682099 13:42862677-42862699 ACATGTCCATGCAAAGATCTAGG + Intergenic
1108714398 13:53064563-53064585 AAATTTCAACACAGAGACATGGG - Intergenic
1109559792 13:64031798-64031820 ACATATCCACACATATACATAGG + Intergenic
1110487354 13:76062184-76062206 CCATTACTACACAAATACCTTGG - Intergenic
1110637987 13:77788232-77788254 GCTTGGCCACACAAAGACCTTGG - Intergenic
1111444167 13:88323712-88323734 GCATTTCAACACAAAAACTTGGG + Intergenic
1111881797 13:93966352-93966374 ACATTCACACACATATACCTTGG - Intronic
1112923433 13:104643660-104643682 ACATTTCCACACCAAGGGCCAGG - Intergenic
1113338562 13:109400306-109400328 ACATTTCTGCACAGAGAACTAGG - Intergenic
1114198447 14:20500226-20500248 ACATTTACACACATAAACCTAGG + Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1115377943 14:32699061-32699083 ACATTTCTAAACACATACCTTGG - Intronic
1116398851 14:44480313-44480335 AGATTTCCCCACAAAGAGCCAGG + Intergenic
1117309177 14:54505099-54505121 ACATTTCAAAATCAAGACCTTGG + Intergenic
1118780914 14:69006995-69007017 ACATTTACAGTCAAGGACCTTGG + Intergenic
1119185690 14:72640770-72640792 ACATTTTCACACCAATTCCTGGG - Intronic
1119784317 14:77301059-77301081 ACATTTCCACAGCAAACCCTTGG + Intronic
1120718466 14:87865481-87865503 ACATTTACCAACAAAGACTTAGG - Intronic
1121106874 14:91286250-91286272 CCGTTCCCACTCAAAGACCTTGG + Intronic
1127559818 15:60124970-60124992 ACATTGCAACATAAAGAACTTGG + Intergenic
1128222333 15:65978104-65978126 CCAGTTCCACACAATGGCCTGGG + Intronic
1128284886 15:66428623-66428645 ACATTTTCACAGAAACACCATGG + Intronic
1130843900 15:87726382-87726404 AAATTTCCACACCAAGAGCCTGG + Intergenic
1131055942 15:89375031-89375053 ACATATCCATACAAAGGTCTCGG - Intergenic
1131210214 15:90488556-90488578 ACATTTCCCCAACAAGACCATGG - Intronic
1133315754 16:4882967-4882989 ACACTGCCCCACAAAGGCCTGGG - Exonic
1133335800 16:5006058-5006080 CCATGTCCACAGACAGACCTGGG + Intronic
1134897134 16:17898330-17898352 ACATTTAAAAACAAAGAACTTGG - Intergenic
1136536818 16:30904438-30904460 ACATTTCCTCTCAAAGGCCGAGG + Intergenic
1136562742 16:31050164-31050186 TCATTTCCACTCAAAGTCCATGG - Intergenic
1140690599 16:77479679-77479701 ATATCTCCACACTAAGACCTGGG + Intergenic
1143788725 17:9276322-9276344 ACATTTCCACAAAAAAAGATGGG - Intronic
1144388229 17:14770012-14770034 ACAATTCCAGAAAAAGACCTCGG + Intergenic
1145770808 17:27491758-27491780 CCACTTCCCCACACAGACCTGGG - Intronic
1149972679 17:61234838-61234860 ACATTTCCTCACAAAGCACTAGG + Intronic
1150565076 17:66331659-66331681 ACACTTCCACTCAAAGTCATTGG + Intronic
1151103466 17:71583648-71583670 ACATGACTTCACAAAGACCTGGG + Intergenic
1152115838 17:78386523-78386545 CAATTTCCACATCAAGACCTGGG - Intronic
1153356997 18:4148264-4148286 ACATTTCTACACAATGGGCTAGG + Intronic
1154090853 18:11361577-11361599 ATATTTCTACATAAAAACCTAGG - Intergenic
1154307114 18:13238759-13238781 ACATTTCCACACAGAAACACAGG - Intronic
1155698417 18:28712547-28712569 ACACTCCCAGACAGAGACCTAGG - Intergenic
1155843113 18:30670381-30670403 ACTTATCCACACATAGTCCTCGG - Intergenic
1156602771 18:38629950-38629972 TCTTTTCCACACAAAGATATTGG - Intergenic
1157518796 18:48330585-48330607 ACATTTCCACATGAAGGCTTGGG + Intronic
1157788895 18:50512361-50512383 ACATATACACACACACACCTAGG + Intergenic
1168310435 19:55457171-55457193 AGATCTCAACACAAAGACCACGG + Intronic
930644725 2:53893294-53893316 CCATTTCCCCACATACACCTAGG - Intronic
931457901 2:62426535-62426557 ACCTTTCCACACACACAGCTGGG + Intergenic
932708477 2:74045662-74045684 ACATTCCCACACACAGCCCCAGG - Intronic
934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935436279 2:103037814-103037836 ACATTTCCAAACAAAAACTGAGG - Intergenic
935554055 2:104487766-104487788 ATATGTCCACACAAACACTTGGG + Intergenic
937488894 2:122344969-122344991 ATATGTCCACACCAAGAGCTAGG - Intergenic
938110687 2:128562992-128563014 ACATTTCAAGACAATGCCCTGGG - Intergenic
938365245 2:130728624-130728646 ACATTTCCTCACAGAGCCTTGGG - Intergenic
938933375 2:136106966-136106988 ACATTTACACAGAAAGCACTTGG + Intergenic
940097135 2:149989780-149989802 GCATTGGCACACAATGACCTAGG - Intergenic
940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG + Intergenic
940799426 2:158116998-158117020 ACTTTTGGACACAAAGACTTTGG - Intronic
940849840 2:158677750-158677772 ACATTTCAACACCAAGCTCTGGG + Intronic
941684797 2:168437540-168437562 ACAAATCCACACTAGGACCTGGG + Intergenic
942542796 2:177032082-177032104 ACATTTCCACATGATGACATAGG - Intergenic
945284774 2:208071162-208071184 ACATTTCCAGCCAAAGATCAGGG + Intergenic
946669907 2:222091440-222091462 ACCTTTTCACAGAAAGTCCTGGG + Intergenic
946882440 2:224190255-224190277 ACATTTGCACACAATAATCTCGG - Intergenic
1170593159 20:17786586-17786608 ATATTTCCAAACACAGAGCTGGG + Intergenic
1170600132 20:17835686-17835708 CCCTTCCCAGACAAAGACCTGGG + Intergenic
1171486987 20:25492389-25492411 GCAGATCCACACAAAGACCCAGG + Intronic
1171945929 20:31377631-31377653 ACATATACACACACAGACCCAGG - Intronic
1172209505 20:33186908-33186930 ACATTTAAGCACAAAGACATAGG + Intergenic
1172233194 20:33350937-33350959 ACATTTAAACACAAAGACATAGG + Intergenic
1172391524 20:34568457-34568479 GCCTTCCCACACACAGACCTGGG + Intronic
1173398011 20:42698775-42698797 ACATGACCACCCAAAGACCCGGG - Intronic
1173627155 20:44481413-44481435 GCATTTCAACACAATGACCAGGG + Intronic
1175679432 20:60975172-60975194 TCCTTTCCACCCAAGGACCTAGG + Intergenic
1178336056 21:31744683-31744705 CCATTTCTCCACAAAGCCCTTGG - Intergenic
1179327211 21:40359497-40359519 ACATGTTCACTCAAAGACTTAGG + Intronic
1182306482 22:29372635-29372657 ACATTTCCATCTAAAGACTTTGG + Intronic
1183193273 22:36335574-36335596 ACTTTTCCTCAGAAAGACATTGG + Intronic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
953276385 3:41503349-41503371 ACATTTCCACTGACAGCCCTTGG - Intronic
953786048 3:45912042-45912064 ACATTTCCTGACAAAGACGCTGG - Intronic
954310750 3:49765184-49765206 ACATTTCCAGATAAAGACTAAGG + Intronic
954447627 3:50555215-50555237 ACATCTCCAGACAGAAACCTTGG + Intergenic
954592996 3:51800144-51800166 AGATTTCCACAAAAACCCCTAGG - Intergenic
956300660 3:67768927-67768949 ATATATCCTCACAAAAACCTGGG - Intergenic
958544471 3:95524599-95524621 ACATGTCAACACAAAGACTTTGG - Intergenic
959116378 3:102183502-102183524 ACAATTACACAAAAGGACCTGGG - Intronic
959770697 3:110091459-110091481 ACATTTTCACACTCTGACCTTGG + Intergenic
960100203 3:113734085-113734107 AGATTTCCACACATACACCATGG + Intronic
962084663 3:132177864-132177886 ACATATATACACCAAGACCTTGG + Intronic
962153734 3:132921702-132921724 ACTTTTGAACACTAAGACCTGGG + Intergenic
966490336 3:180520870-180520892 ACATAAACACACAAATACCTAGG + Intergenic
967409206 3:189150474-189150496 AGAAATCCACACAAAGATCTCGG - Intronic
969006474 4:4024185-4024207 ATATGGCCACTCAAAGACCTAGG - Intergenic
969202910 4:5619989-5620011 ACATTCCCACACTGAGATCTGGG - Intronic
970878750 4:20903276-20903298 ACATTTCTACAGAAAGACATAGG - Intronic
973601406 4:52546402-52546424 ACATTTCCCCAGAATGCCCTGGG - Intergenic
974496749 4:62639344-62639366 ACATTTCCAGATAAAAGCCTAGG + Intergenic
975843459 4:78500830-78500852 ACTTTTCCGCATAAAGATCTGGG + Intronic
976385033 4:84447294-84447316 ACACTAGCACACAAAGAGCTGGG + Intergenic
976980765 4:91224434-91224456 CCATTGTCACACAAAGACATTGG - Intronic
977476353 4:97514843-97514865 ACATTACCTCGCAAAGTCCTGGG + Intronic
977711412 4:100130395-100130417 CTATTTCCTGACAAAGACCTAGG - Intergenic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
978690856 4:111507569-111507591 ACATTAGTACACACAGACCTGGG + Intergenic
979840683 4:125436255-125436277 AGTTTTCCACTCAAACACCTAGG + Intronic
980420208 4:132548743-132548765 ACATATACACACTAAAACCTAGG - Intergenic
980779975 4:137481879-137481901 AAATTTCCTGCCAAAGACCTAGG + Intergenic
982726056 4:158907949-158907971 AAATTCCCACACAATGACATTGG - Exonic
985543845 5:499556-499578 ACGTTTCCACACAGGGACCCTGG - Intronic
986279527 5:6312065-6312087 CTATTTCCAGAAAAAGACCTGGG - Intergenic
986421152 5:7584605-7584627 ACATTTTTACATAAAGACTTCGG - Intronic
986983994 5:13479836-13479858 GGAATTCCACACAAAGACTTTGG - Intergenic
987968010 5:24901722-24901744 ACATTTCCCCAAAAAGATTTTGG + Intergenic
988672371 5:33395739-33395761 ATATTTCCAAACAAAGCTCTGGG + Intergenic
990027767 5:51216094-51216116 ACATTTCCTCAGAAATACTTAGG - Intergenic
992120865 5:73590684-73590706 GCATTACCACACAAAGACTTTGG - Intergenic
993020685 5:82586800-82586822 ACCTTTCCCCACAAAGACATTGG - Intergenic
993314409 5:86382486-86382508 ACATTTCCATTCCAACACCTGGG + Intergenic
993476535 5:88373269-88373291 CCATTACCACCCAAAGCCCTTGG - Intergenic
995936775 5:117526085-117526107 ACATTTGCACACAATCATCTTGG - Intergenic
997671144 5:135673195-135673217 ACATTTTCACACAAAGATTTAGG - Intergenic
999004169 5:147957652-147957674 AGAGTTCCACACAAGGACATGGG - Intergenic
999885995 5:155923552-155923574 CAATTTCCACACAAGGCCCTTGG + Intronic
1000619303 5:163464970-163464992 ACATTTAAACATAATGACCTAGG - Intronic
1000999617 5:167993523-167993545 ACATTTCAAAGCACAGACCTGGG - Intronic
1001000247 5:167999269-167999291 ACATTTCCACCCAACTCCCTGGG + Intronic
1002359206 5:178656998-178657020 ACATTTGGACAGACAGACCTTGG + Intergenic
1003471666 6:6441904-6441926 TCATTTCAACAAAAAGAGCTGGG + Intergenic
1004999031 6:21222390-21222412 ACATTTCCATTATAAGACCTCGG - Intronic
1005429450 6:25739723-25739745 ACATTTCAAAACAAAGTCATAGG + Intergenic
1006986637 6:38179926-38179948 AGATTTCCACATAAAGATCTGGG + Intronic
1007549898 6:42721254-42721276 ACATATCCAGACAAACATCTTGG + Intronic
1007893768 6:45325386-45325408 GCATTTAAACACAAATACCTTGG + Intronic
1008148219 6:47918085-47918107 TCTTTTCCACACAAAATCCTAGG + Intronic
1008294969 6:49764685-49764707 TTATTTCCACACAATGACCCTGG + Intergenic
1012019046 6:93892877-93892899 ACATATCCACACTTAGAACTAGG - Intergenic
1012143607 6:95653729-95653751 ATATATCCACACAAATACCTGGG + Intergenic
1016101481 6:140106242-140106264 AGATTTTCTCACCAAGACCTTGG + Intergenic
1016471111 6:144375560-144375582 ACATATCCAAACAAAGAGCCTGG - Intronic
1016684392 6:146864868-146864890 ACCTTTCCAGACAACGTCCTTGG + Intergenic
1016966494 6:149722762-149722784 ACATTTTCTCACAATAACCTTGG + Intergenic
1019916148 7:4134020-4134042 GCTTTCCCACTCAAAGACCTTGG - Intronic
1022212191 7:28222367-28222389 ACATTTCCACATATTGAGCTGGG - Intergenic
1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG + Intronic
1023563337 7:41498501-41498523 ACAGAGCCACACTAAGACCTGGG + Intergenic
1023578086 7:41651340-41651362 ACATATACACACACACACCTTGG - Intergenic
1029407596 7:100385468-100385490 ACACTTCCACACAAAGTGGTAGG - Intronic
1029909399 7:104128815-104128837 ACATTTCTCCACAATGACTTTGG + Intronic
1029997783 7:105025903-105025925 AGATTGCCCCACAAAGATCTAGG + Intronic
1030586688 7:111429431-111429453 AGCTTTCCACACATAGACCAGGG + Intronic
1033713094 7:143969669-143969691 CCATCTCCACAGAAAGACTTTGG - Intergenic
1034497247 7:151430399-151430421 ACAATTCCCCACCAAGAGCTGGG - Intronic
1034993839 7:155565878-155565900 ACATTCCCTCCCACAGACCTGGG + Intergenic
1035897811 8:3423702-3423724 ACATTTCCACACAAAGACCTGGG - Intronic
1036383059 8:8251717-8251739 ACATTCCCACACAAAGAATAAGG - Intergenic
1037240015 8:16766505-16766527 ACATTTTCAAACACATACCTAGG + Intergenic
1038031092 8:23641074-23641096 ACAATTCAACTCAAAGACGTGGG + Intergenic
1039216290 8:35275265-35275287 ACCCTTCCTCCCAAAGACCTTGG + Intronic
1040727817 8:50404378-50404400 ACATATCCACACAAATATTTTGG - Intronic
1041837866 8:62237413-62237435 ATATTTCCACAAAAAAACCCAGG + Intergenic
1042023697 8:64400006-64400028 CCATTTTCACACACAGACCCTGG + Intergenic
1043205364 8:77432111-77432133 AGATTGCCATACAAAAACCTAGG + Intergenic
1044923851 8:97192972-97192994 AGGTTTCCACAGAAAGAGCTGGG + Intergenic
1046601367 8:116320822-116320844 AAATTTCCACACAAACATTTCGG + Intergenic
1046628046 8:116596161-116596183 TCATTTCCACATCAAAACCTTGG + Intergenic
1047160411 8:122371543-122371565 AAATTTTCATGCAAAGACCTAGG + Intergenic
1047429358 8:124777181-124777203 GCATTTCCAAGCAAAGACCTGGG - Intergenic
1052010702 9:23405271-23405293 ACATTTTCACAAAAAAGCCTAGG - Intergenic
1052687849 9:31777127-31777149 AAATTTCCAAACCAATACCTGGG + Intergenic
1052997064 9:34556850-34556872 CCAGTTCCAAACTAAGACCTGGG + Intronic
1053926972 9:43071188-43071210 TCATTTCCACACAAAGAAGATGG - Intergenic
1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG + Intergenic
1054388314 9:64585098-64585120 TCATTTCCACACAAAGAAGATGG - Intergenic
1054815066 9:69466776-69466798 ACGTTACCACACAAACACCAGGG + Intronic
1055240038 9:74172623-74172645 ACATTACCACCCTTAGACCTAGG - Intergenic
1056062892 9:82902587-82902609 TCATTTAGACACACAGACCTGGG - Intergenic
1056792946 9:89637972-89637994 GGATTTCCACACACAGAGCTCGG - Intergenic
1186969494 X:14824933-14824955 ACATTTTCAGACAAAGACCAAGG - Intergenic
1188432504 X:30120758-30120780 AAATGTGCCCACAAAGACCTTGG + Intergenic
1190100418 X:47518487-47518509 ACATTTCCACCCTATGCCCTAGG + Intergenic
1191111775 X:56809367-56809389 ACATTCCCACACAAAAACAGTGG - Intergenic
1194078705 X:89431065-89431087 ACATATACACAAAAATACCTAGG - Intergenic
1198223740 X:134626437-134626459 AAATTTCCACAAAATGAACTAGG - Intronic
1200431312 Y:3086187-3086209 ACATATACACAAAAATACCTAGG - Intergenic
1201721838 Y:17107104-17107126 ACATTTCAACACTATCACCTTGG - Intergenic