ID: 1035898601

View in Genome Browser
Species Human (GRCh38)
Location 8:3433097-3433119
Sequence CGTTTTATACAGAGATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035898598_1035898601 9 Left 1035898598 8:3433065-3433087 CCTAGTTTTTAAAAGTTATAATC 0: 1
1: 0
2: 5
3: 70
4: 618
Right 1035898601 8:3433097-3433119 CGTTTTATACAGAGATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035898601 Original CRISPR CGTTTTATACAGAGATTGGA AGG Intronic
No off target data available for this crispr