ID: 1035901801 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:3465133-3465155 |
| Sequence | GCTGCTGGGGCCTCACCAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035901797_1035901801 | 30 | Left | 1035901797 | 8:3465080-3465102 | CCAACTGAAGTCTAGCAAGAGCG | 0: 1 1: 0 2: 0 3: 5 4: 52 |
||
| Right | 1035901801 | 8:3465133-3465155 | GCTGCTGGGGCCTCACCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035901801 | Original CRISPR | GCTGCTGGGGCCTCACCAGC AGG | Intronic | ||
| No off target data available for this crispr | |||||