ID: 1035901801

View in Genome Browser
Species Human (GRCh38)
Location 8:3465133-3465155
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035901797_1035901801 30 Left 1035901797 8:3465080-3465102 CCAACTGAAGTCTAGCAAGAGCG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr