ID: 1035903939

View in Genome Browser
Species Human (GRCh38)
Location 8:3488629-3488651
Sequence TATGCTAGGACTCAGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035903939 Original CRISPR TATGCTAGGACTCAGCGAGG AGG (reversed) Intronic
901218098 1:7565898-7565920 TATGTGAGGACACAGCGAGAAGG - Intronic
903552880 1:24170119-24170141 TATGCGAAGACGCAGCGAGAAGG + Intronic
905937366 1:41835346-41835368 CATGCTGGGACGCAGTGAGGAGG - Intronic
906349806 1:45048831-45048853 TATGATAGGAATCAGCATGGTGG + Intronic
916074217 1:161191035-161191057 CATGCTAAGACTCAGTGGGGAGG - Exonic
920032849 1:203047992-203048014 AAGGCTAGGCCTGAGCGAGGAGG + Intronic
920261489 1:204691099-204691121 TATGATGGGTCTCAGTGAGGTGG - Intergenic
1062855837 10:779131-779153 TATGCTCGGCCTCAGGGAGTGGG - Intergenic
1068530051 10:58175558-58175580 TATGCGAGGACACAGGGAGTAGG + Intergenic
1071289627 10:84179452-84179474 GATGCTGGGATTCAGCAAGGAGG + Intronic
1073585873 10:104709290-104709312 TATGCAGGGACACAGTGAGGTGG - Intronic
1073978503 10:109127312-109127334 TATGCTGGGACTGGGGGAGGAGG + Intergenic
1074341820 10:112638788-112638810 TTTGCTAGGACTAAGCCAGAAGG - Intronic
1075360499 10:121828379-121828401 TTGGCTAGAACTCAGCTAGGTGG + Intronic
1076983636 11:219373-219395 CATGCTGGGAGACAGCGAGGTGG - Intronic
1077088162 11:765089-765111 TAGGTTAGGACTCAGAGATGGGG + Intergenic
1079615590 11:22488717-22488739 CATGCGAGGACTCAGCAAGAAGG + Intergenic
1079976128 11:27093769-27093791 TATGCGAGGACACAGTGAGAAGG - Intronic
1085136052 11:74089680-74089702 TATGCTAGAACTATGCTAGGAGG + Intronic
1088037280 11:105333233-105333255 CATGTGAGGACCCAGCGAGGAGG + Intergenic
1092450522 12:8597535-8597557 TCTGCTAGGACTGAGCGCGGGGG - Intergenic
1094366405 12:29687782-29687804 AATGGGAGGACACAGCGAGGAGG - Intronic
1095265065 12:40146209-40146231 TATGCTAGCACTGAGCTAGCTGG - Intergenic
1096671302 12:53199701-53199723 TATGTGAGGACACAGCGAGAAGG + Intronic
1101154946 12:101918476-101918498 CATGCTAGGTCACACCGAGGAGG - Intronic
1104836873 12:131797423-131797445 TAGGCAAGGACTCAGGGAGGAGG - Intronic
1107195206 13:37643097-37643119 TATCCCAGGACTCAGATAGGAGG - Intronic
1109417469 13:62060895-62060917 TTGGCTAGAACTCAGTGAGGTGG + Intergenic
1113937464 13:114001959-114001981 GATGCAAGGCCTCAGCGAGGAGG + Intronic
1124395958 15:29301841-29301863 CATGTGAGGACACAGCGAGGAGG + Intronic
1133892234 16:9891515-9891537 TATGTCAGGACTCAGCTAGTTGG + Intronic
1135633917 16:24057779-24057801 CTTGCTAGGACTCAGCTCGGTGG + Intronic
1137573767 16:49584663-49584685 CATGGGAGGACACAGCGAGGGGG - Intronic
1140055904 16:71525548-71525570 TATTCTAGGGCTCAAAGAGGTGG + Intronic
1140506194 16:75474664-75474686 CATGCTAGGACACAGCAAGAAGG - Exonic
1141215560 16:82020085-82020107 TATTCTTGGACTAAGGGAGGTGG + Intergenic
1167851469 19:52205696-52205718 GAAGCTGGGACTCAGAGAGGTGG + Intronic
926476607 2:13330058-13330080 CATGCGAGGACACAGCGAGAAGG - Intergenic
926689380 2:15722598-15722620 TAAGCAAGGCCTCAGGGAGGTGG + Intronic
930851753 2:55968485-55968507 CATGTGAGGACACAGCGAGGAGG + Intergenic
931753781 2:65353802-65353824 TAAGGTAGCACTCAGCGATGGGG - Intronic
933101723 2:78268068-78268090 TATCCTAGCACTCTGGGAGGCGG - Intergenic
934465778 2:94261870-94261892 TATGCATGGATTCAGCAAGGTGG - Intergenic
937439788 2:121906022-121906044 TATGCTCGGGTTGAGCGAGGTGG + Intergenic
942095713 2:172535010-172535032 TATTCTTGGAGGCAGCGAGGAGG + Intergenic
943518054 2:188910929-188910951 TATGTTAGGACACAGCAAGAAGG + Intergenic
1172192088 20:33068307-33068329 TTTGCAAGGCCTCAGTGAGGAGG + Intronic
1174457280 20:50658418-50658440 AATGGTTGGACTGAGCGAGGTGG + Intronic
1177970544 21:27784368-27784390 TATGATGGGCCTCAGCGTGGAGG - Intergenic
1183169612 22:36177314-36177336 GATGCTATGACTCAGCATGGTGG + Intergenic
950252290 3:11475908-11475930 AATGCTCGGACTCTGGGAGGGGG - Intronic
952036074 3:29203212-29203234 TATTCTAGGACTCAGCTATATGG + Intergenic
953577302 3:44123242-44123264 CATGTGAGGACTCAGCGAGGAGG + Intergenic
957479228 3:80770108-80770130 TGTGGTAGCTCTCAGCGAGGTGG + Intergenic
959576212 3:107937098-107937120 TATGCTGGGACCCAGCAAGAGGG - Intergenic
959905355 3:111705102-111705124 TATGCTAGGACCAGGCGTGGTGG - Intronic
960614547 3:119584863-119584885 CATGTGAGGACACAGCGAGGAGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
966157548 3:176933513-176933535 GTTGCTAGCACTCAGGGAGGAGG - Intergenic
970363160 4:15330587-15330609 TATGTGAGGACACAGAGAGGAGG - Intergenic
970928891 4:21485651-21485673 TCTGCTAGGGCTGGGCGAGGAGG - Intronic
975320371 4:73003634-73003656 TATGCGAGGACACAGCAAGAAGG + Intergenic
975762263 4:77631773-77631795 GATGCTATGAGTCAGCCAGGGGG + Intergenic
976008209 4:80456155-80456177 CATGCTTGGACACAGCAAGGAGG + Intronic
976183114 4:82417878-82417900 TATGGTAGGGCTAGGCGAGGTGG - Intergenic
976376320 4:84349734-84349756 CATGCTATGACTCAGCAAGAAGG - Intergenic
976545368 4:86329078-86329100 TATGTGAGGACTCAGCAAGAAGG + Intronic
976777695 4:88723851-88723873 TATTCGAGGCCTGAGCGAGGAGG + Intergenic
979468845 4:121071923-121071945 TGTGCTAGGTCTCAGGGTGGCGG + Intronic
982115337 4:152094243-152094265 CATGTGAGGACACAGCGAGGAGG + Intergenic
992734763 5:79707930-79707952 TGTGTGAGGACTCAGCAAGGAGG - Intronic
995089683 5:108159536-108159558 TATGTGAGGACTCAGTGAGAAGG + Intronic
999740276 5:154544618-154544640 TATGTGAGGGCTCAGCGAGAAGG + Intergenic
1006137151 6:31902061-31902083 TCGGCTAGGACTCGGGGAGGAGG + Intronic
1006876496 6:37301949-37301971 TATGCTATGATTCAGTGAGATGG - Intronic
1009973436 6:70648582-70648604 TATGTGAGGAATCAGTGAGGAGG + Intergenic
1014598712 6:123380488-123380510 TATACTACAACTCAGCCAGGGGG - Intronic
1017631242 6:156397891-156397913 TATGGTGGGACTGAGTGAGGGGG - Intergenic
1022540373 7:31129234-31129256 TATCCTAGGTCTCAGCTAGGTGG + Intergenic
1024202413 7:47120591-47120613 TCTGCTGGGACTCAGGCAGGGGG + Intergenic
1029273996 7:99393471-99393493 ATTGCTAGCACTTAGCGAGGTGG + Intronic
1033483434 7:141764158-141764180 CATGATGGGACTCACCGAGGGGG + Exonic
1034283560 7:149869810-149869832 TATGATACGACTCAGCTTGGAGG - Intergenic
1034512771 7:151549818-151549840 CATGCTATGACTCAGCAAGAAGG + Intergenic
1035719312 8:1779734-1779756 CATGCTAGGACACAGCCAGAAGG - Intronic
1035903939 8:3488629-3488651 TATGCTAGGACTCAGCGAGGAGG - Intronic
1045560437 8:103256642-103256664 TTTGCTAGGACTTAGTGAGTTGG + Intergenic
1045796421 8:106050467-106050489 TCTGCTGGGACCCAGGGAGGAGG - Intergenic
1047184933 8:122624370-122624392 TATGTGAGGACACAGTGAGGAGG - Intergenic
1050555772 9:6788673-6788695 TATGCTAGGGCTTAAAGAGGTGG + Intronic
1056554639 9:87678351-87678373 TGTGCTAGGACACAGGCAGGAGG + Intronic
1058608390 9:106748407-106748429 TATGCGAGGACACAGCTAGAAGG - Intergenic
1059744032 9:117182780-117182802 TATTCTAGGACACAGAGATGGGG - Intronic
1061903171 9:133683382-133683404 TATGCCAAGCCTCAGCAAGGTGG + Intronic
1185970891 X:4662410-4662432 TATGTGAGGACACAGCGAGAAGG - Intergenic
1187178180 X:16915794-16915816 TATGTGAGGACACAGCGAGAAGG + Intergenic
1188573886 X:31622587-31622609 TATGTTAGGACACAGAGAGAAGG + Intronic
1190117716 X:47637073-47637095 AATGCTAGGAGGCAGCGAGCTGG + Exonic
1190242415 X:48667828-48667850 TATGTGAGGACACAACGAGGAGG - Intergenic
1190916713 X:54816595-54816617 TCGGATAGGACTCAGAGAGGGGG + Intergenic
1196726458 X:118900285-118900307 GATGCTGGGACTCAGAGAGGTGG + Intergenic
1197940480 X:131783562-131783584 TATGCTAGGCCTCAGAGAAAAGG + Intergenic
1198817107 X:140603366-140603388 TATGTGAGGACACAGCGAGAAGG - Intergenic