ID: 1035906447

View in Genome Browser
Species Human (GRCh38)
Location 8:3515647-3515669
Sequence CAAGTTGGTCTGTTGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035906447_1035906450 5 Left 1035906447 8:3515647-3515669 CCAACTTGCAACAGACCAACTTG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1035906450 8:3515675-3515697 AGTCAATCATCACATATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035906447 Original CRISPR CAAGTTGGTCTGTTGCAAGT TGG (reversed) Intronic
901768874 1:11520627-11520649 CCAGCTGGTCTGTTCCCAGTGGG - Intronic
902580357 1:17404058-17404080 AAAGATGGCCTGTTGCAGGTTGG - Intergenic
902935011 1:19758753-19758775 CAAGTTGGCCCCTGGCAAGTTGG - Intronic
904896049 1:33819290-33819312 CAAGTCTGTCTGTTGCAATATGG + Intronic
908338615 1:63153002-63153024 AAAGTTGGTCTGTTCCAAGAGGG + Intergenic
910494458 1:87810958-87810980 CAAATTTCTCTGATGCAAGTTGG + Intergenic
914848947 1:151299848-151299870 CAAATTGGTCTGTAGCAGGTAGG - Intronic
918170270 1:181989668-181989690 CAAGGTTGTCTGCTGCGAGTGGG - Intergenic
919946134 1:202320177-202320199 AAAGTTTGTCTGCTGCAAGAGGG + Intergenic
921401840 1:214732753-214732775 CAAGTTTGACTTTTGCAACTTGG + Intergenic
1063674814 10:8131484-8131506 CTAGTTGTTCGGTTGCATGTAGG + Intergenic
1065567422 10:27027753-27027775 TAAGTTGGGCTATTGTAAGTTGG - Intronic
1065853304 10:29809438-29809460 GAAGTTGGTTTGTTCTAAGTAGG + Intergenic
1088600701 11:111472100-111472122 CACTTTGCTGTGTTGCAAGTAGG - Intronic
1089536069 11:119161460-119161482 CACTTTGGTCAGTTGTAAGTGGG - Exonic
1090416215 11:126542280-126542302 CAAGATGGTCTGTGTCCAGTTGG - Intronic
1091511523 12:1131890-1131912 CAAGTTTGTCTGTAGCAAACAGG - Intronic
1093321629 12:17721239-17721261 CAAGTTGGTCTGGTGAGACTGGG + Intergenic
1095994340 12:48067240-48067262 AATGTTGGTCTCATGCAAGTAGG - Intronic
1097894423 12:64810191-64810213 CAATATGGGCTGTTGGAAGTGGG - Intronic
1101233785 12:102767759-102767781 CAGGTTGTTCTGTTGCTGGTTGG + Intergenic
1106626085 13:31422389-31422411 GAAGTTAGTCTATTGGAAGTGGG - Intergenic
1108503977 13:51093120-51093142 CAAGTTGGTTTGTTCAAATTAGG + Intergenic
1111123610 13:83883714-83883736 TAATTAGGTCTTTTGCAAGTTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112057781 13:95706723-95706745 CAAGTTGGTCAGTTTCATTTGGG + Intronic
1118080673 14:62355959-62355981 CTGGTTGGTCTATTGAAAGTAGG + Intergenic
1121554356 14:94825080-94825102 TAATTTGGTAAGTTGCAAGTAGG + Intergenic
1141076898 16:81014787-81014809 TAAGTTGAGCTGTTGTAAGTTGG - Intronic
1145908108 17:28527359-28527381 CAGGTGGGTCTGGGGCAAGTGGG + Exonic
1151750802 17:76036548-76036570 CGAATGGGTCTGTTCCAAGTGGG - Intergenic
1155288922 18:24321324-24321346 TAAGTTGAACTGTTGTAAGTTGG - Intronic
1155622151 18:27791871-27791893 AAAGTAGGTTTGTTCCAAGTAGG + Intergenic
1156958585 18:42995788-42995810 CAAGTTGGTCTGGTGAGACTGGG - Intronic
1163893954 19:20040842-20040864 TTAATTGGTCTGTTGCAACTTGG - Intergenic
1167111882 19:47467407-47467429 CGTGTTTGTCTGTTTCAAGTGGG + Intronic
925624288 2:5826569-5826591 CAACTTGGACTCTTGCAAGCTGG - Intergenic
926885237 2:17591558-17591580 TCAGTTGGTCTGGTTCAAGTTGG - Intronic
929832520 2:45358503-45358525 CAGATTGTTCTGTTCCAAGTGGG - Intergenic
932303811 2:70687275-70687297 CAAGTTGGTCAGGGGCAGGTAGG - Intronic
935086961 2:99857633-99857655 GAAGTTGATCTGCTGCAAGCTGG - Intronic
935229427 2:101083000-101083022 CAAGTTCTTCCGTTGCACGTTGG + Intronic
936370889 2:111901412-111901434 TAAGTTGTTCTGTTGCTTGTGGG + Intronic
938999805 2:136721197-136721219 AAAGTTGGTCTGCTCCAGGTTGG + Intergenic
939701821 2:145401654-145401676 CAAGTTGATCTGCTGAAAGAGGG - Intergenic
944142608 2:196473644-196473666 AAATTTGGTCTGTAGAAAGTTGG - Intronic
945690208 2:213024548-213024570 CAAGAAGGTCTGTTTGAAGTAGG + Intronic
1171284112 20:23923722-23923744 CAAGTTGGGCACTTGCAATTGGG - Intergenic
1175050099 20:56147307-56147329 CAAGTGAGTCTGTTGGAAGTGGG - Intergenic
1178018867 21:28385856-28385878 CAAGTGATTCTGATGCAAGTAGG + Intergenic
1178318218 21:31584854-31584876 GAGGTAGGTCTGTAGCAAGTAGG - Intergenic
951537773 3:23755183-23755205 CAAGTTATTCTTTTGCAAGCAGG - Intergenic
954811285 3:53249866-53249888 CAAACTGGTCTGTGGCAAGAAGG + Intronic
957484148 3:80835500-80835522 TAACTTGGTATCTTGCAAGTAGG + Intergenic
958263483 3:91409274-91409296 CATGTTGCTCTGTGGGAAGTAGG + Intergenic
959284460 3:104390500-104390522 CAAGTTGGTCTGTTGACACGTGG + Intergenic
959616831 3:108358155-108358177 CATGTAGGTAAGTTGCAAGTAGG + Exonic
960450693 3:117803772-117803794 AAAGTCGGCATGTTGCAAGTAGG - Intergenic
963436126 3:145269059-145269081 TAAGTTGGACCATTGCAAGTTGG - Intergenic
989537471 5:42581512-42581534 GAAGTTGGTCTTCTGAAAGTTGG + Intronic
992789291 5:80199075-80199097 GAATGTGGTCTGTGGCAAGTGGG - Intronic
994692118 5:103032599-103032621 GAAGTTGGTATGTGGCAGGTTGG - Intergenic
999453284 5:151694392-151694414 TCAGTGGGTGTGTTGCAAGTGGG - Intergenic
1000576027 5:162976098-162976120 CAAGTTCATCTGTTCCATGTTGG + Intergenic
1002720747 5:181260202-181260224 CATGTTGGCCAGCTGCAAGTTGG + Exonic
1003541940 6:7025665-7025687 CAAGTTGGCCTGGTGAAAGGGGG - Intergenic
1005806275 6:29476858-29476880 TAAGTTGCTCTGTTACATGTAGG + Intergenic
1008991951 6:57613703-57613725 CATGTTGCTCTGTGGGAAGTAGG - Intronic
1009180552 6:60512651-60512673 CATGTTGCTCTGTGGGAAGTAGG - Intergenic
1010387630 6:75300455-75300477 CAAGTTGTTCTGAGGCCAGTAGG - Intronic
1018427028 6:163692373-163692395 CATTTTTGGCTGTTGCAAGTTGG + Intergenic
1022702997 7:32778798-32778820 CAAGTGGGCTTGTTGCAAGTAGG - Intergenic
1025605213 7:63035234-63035256 CACATTGGTCTGTTTTAAGTAGG + Intergenic
1031354778 7:120777613-120777635 CAAGTTGGTCTGGTGAGACTGGG + Intergenic
1032850852 7:135793863-135793885 CAAGTTGGCTTGTTGCAATATGG + Intergenic
1035906447 8:3515647-3515669 CAAGTTGGTCTGTTGCAAGTTGG - Intronic
1039861589 8:41463613-41463635 CCAGTTGGTCTGTAGCACTTTGG - Intergenic
1041428654 8:57752591-57752613 CAGTTTGGTCATTTGCAAGTTGG - Intergenic
1041721293 8:60978448-60978470 TAAGTTGGTTTGTTGAAACTAGG + Intergenic
1042418213 8:68551954-68551976 CAAATTGGTGTTTTGCATGTGGG - Intronic
1050256686 9:3799684-3799706 CAAGTTGAACTATTGTAAGTTGG - Intergenic
1060234099 9:121850278-121850300 AAAGATGGTCTGTTGTATGTGGG - Intronic
1186209232 X:7232439-7232461 CATTTTGTTCTGTTGCAATTTGG + Intronic
1197276825 X:124489185-124489207 CAAGTTGGTCCATTGCCAGGTGG - Intronic
1198423482 X:136492204-136492226 TCAGTTGTTCTGTTGCAAGGCGG + Exonic
1199974626 X:152885937-152885959 CAAGTTTGTCTTTTCCAAGAGGG - Intergenic
1200413215 Y:2882014-2882036 CATGTTGATCTGTGGCAATTTGG + Intronic
1201983408 Y:19932461-19932483 CATGTTGATCTGTTGCCATTTGG + Intergenic