ID: 1035910365

View in Genome Browser
Species Human (GRCh38)
Location 8:3558937-3558959
Sequence CCGTCATACTGGGCTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035910365_1035910373 24 Left 1035910365 8:3558937-3558959 CCCAGAGTAGCCCAGTATGACGG No data
Right 1035910373 8:3558984-3559006 GACTAGAAGTGGGACTGCCGTGG No data
1035910365_1035910372 14 Left 1035910365 8:3558937-3558959 CCCAGAGTAGCCCAGTATGACGG No data
Right 1035910372 8:3558974-3558996 AAAGATAAATGACTAGAAGTGGG No data
1035910365_1035910371 13 Left 1035910365 8:3558937-3558959 CCCAGAGTAGCCCAGTATGACGG No data
Right 1035910371 8:3558973-3558995 AAAAGATAAATGACTAGAAGTGG No data
1035910365_1035910374 27 Left 1035910365 8:3558937-3558959 CCCAGAGTAGCCCAGTATGACGG No data
Right 1035910374 8:3558987-3559009 TAGAAGTGGGACTGCCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035910365 Original CRISPR CCGTCATACTGGGCTACTCT GGG (reversed) Intronic