ID: 1035911258

View in Genome Browser
Species Human (GRCh38)
Location 8:3569104-3569126
Sequence CAATTGGAACAGCTCATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035911258_1035911263 19 Left 1035911258 8:3569104-3569126 CCTGGTATGAGCTGTTCCAATTG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1035911263 8:3569146-3569168 ACTAAAGGAATCTTCTTGAGAGG No data
1035911258_1035911260 4 Left 1035911258 8:3569104-3569126 CCTGGTATGAGCTGTTCCAATTG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1035911260 8:3569131-3569153 AAAATCTGCCTCTCCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035911258 Original CRISPR CAATTGGAACAGCTCATACC AGG (reversed) Intronic
907772972 1:57484413-57484435 CAGTTGCATCAGCTCATAGCTGG - Intronic
907868847 1:58424669-58424691 CAATTGTCACAGCTCTTAACTGG - Intronic
909145249 1:71922137-71922159 CTATTGGCACAGCTCACACTGGG - Intronic
909262817 1:73515741-73515763 CAATTGGCAAAGATAATACCAGG + Intergenic
910522967 1:88144411-88144433 CAATCAGAGCAGTTCATACCTGG - Intergenic
912692871 1:111818005-111818027 CTATGGGAACAGCTCACACCTGG - Intronic
913379667 1:118195570-118195592 CAAGTTGAACAGCTAATATCAGG - Intergenic
916896531 1:169169174-169169196 CAAGGGGAACATCACATACCAGG + Intronic
919062945 1:192657430-192657452 CAATTGGAAAAGCTCCTCCTTGG + Intronic
922669170 1:227495627-227495649 CCTTTGGAGCAGCTCAAACCCGG + Intergenic
922670426 1:227505675-227505697 CCTTTGGAGCAGCTCAAACCCGG - Intergenic
923415752 1:233758065-233758087 CAATTGCAGAAGCTCATACGTGG + Intergenic
1068970772 10:62956213-62956235 CAATTGGATTGGCTCATCCCAGG + Intergenic
1069764620 10:70845338-70845360 AAATTGGAACAGCACTTACATGG + Intronic
1070515604 10:77203133-77203155 CAACTAGAACAGCTCAATCCGGG + Intronic
1076093776 10:127713680-127713702 CAATGGGAAGAGCTCTGACCAGG - Intergenic
1078898761 11:15622058-15622080 CATTTGGAACAGCAGATAGCTGG + Intergenic
1082077568 11:47986142-47986164 CAAATGGAGCAGATCATACAGGG - Intronic
1088367066 11:109051048-109051070 CAATGGGAACATCACACACCGGG + Intergenic
1091765521 12:3117762-3117784 CTATGGGAACAGCACATCCCAGG + Intronic
1095682656 12:44996918-44996940 CAAAGGGAACAACACATACCAGG - Intergenic
1098265007 12:68709020-68709042 CAATTGTAGCTGCTCTTACCTGG - Intronic
1102492213 12:113296294-113296316 CAGTAGGAAGAGCTCAGACCTGG - Exonic
1105820852 13:24079447-24079469 CAAATGGAAAAGCCCAGACCGGG - Intronic
1110554278 13:76840627-76840649 CAATTTGAACTGCTAATACAAGG + Intergenic
1114479557 14:23024089-23024111 CAATTTGAACACCTCTTCCCTGG - Intronic
1118688230 14:68313136-68313158 CAATTGCAACTGCTTATACCTGG + Intronic
1120441296 14:84543996-84544018 CAATTGGAGCAGCTCTTAAATGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125399125 15:39281619-39281641 GAAGTGGAACATCACATACCGGG - Intergenic
1125719555 15:41838815-41838837 CAATTGGGACATCACATCCCTGG + Exonic
1127960469 15:63886809-63886831 CAGTTGGAACAGGTCCTACTGGG - Intergenic
1142160020 16:88552522-88552544 CACTTGGAACAGCCCACAGCTGG - Intergenic
1143309895 17:5979407-5979429 CAATTAAATGAGCTCATACCAGG + Intronic
1153028260 18:690341-690363 CAATTCTGACAGCACATACCTGG - Intronic
1156034141 18:32748156-32748178 CACTTAGAACAGCTGAAACCAGG - Intronic
1157696345 18:49726714-49726736 CCATAGTAACAGCTCATTCCTGG + Intergenic
1161386159 19:3994496-3994518 CAATGTGAGCAGGTCATACCCGG - Intergenic
1165849617 19:38841944-38841966 CCACTGGCACACCTCATACCAGG - Intronic
928276888 2:29909660-29909682 CAATTTCTACAGCTCATACATGG + Intronic
937272851 2:120664893-120664915 AAATGGGAAGAGCACATACCTGG - Intergenic
938979017 2:136507983-136508005 CACTTGGATCAACTCACACCTGG - Intergenic
944180999 2:196894069-196894091 CAATTTTAACAACTCTTACCAGG + Intronic
945367704 2:208976898-208976920 TCAGTGGAACAGCTGATACCAGG + Intergenic
946719601 2:222590334-222590356 GAAGTGGAACATCACATACCGGG + Intronic
947450379 2:230202946-230202968 TGATTGCAACAGGTCATACCAGG - Intronic
1175248534 20:57595650-57595672 CACTTGTAACATCTCACACCTGG + Intergenic
1180119511 21:45737438-45737460 AAATGGGAACAGCACATAACAGG - Intronic
1180154835 21:45972766-45972788 CGAGTGGCACAGCTCAGACCTGG - Intergenic
1181080350 22:20410416-20410438 CGATGGGAACAGCTCACAGCAGG - Intergenic
953751092 3:45609106-45609128 AAATTGGCACAGCTACTACCAGG - Intronic
956334539 3:68148486-68148508 TAATTGTAACAGTTCACACCAGG + Intronic
971815548 4:31483608-31483630 CAATTGAAGCTTCTCATACCAGG - Intergenic
975837712 4:78441964-78441986 CAATTGAGACAGCTCATGGCAGG + Intronic
981849925 4:149218354-149218376 CAGGTGGAACAGCTCCCACCGGG + Intergenic
982273198 4:153613015-153613037 CAATAGGAACATCTAACACCAGG + Intronic
983521385 4:168712544-168712566 CAATGGAAACAGCTCATGCAAGG - Intronic
988870435 5:35384296-35384318 CAGGTGGAACAGCTCCCACCGGG + Intergenic
988961594 5:36376540-36376562 CAAATGGACCTCCTCATACCAGG - Intergenic
990479960 5:56200764-56200786 CAATTTCAAGAGCTCAGACCAGG + Intronic
990934224 5:61129945-61129967 GAATTAGAACAGCTCTTATCTGG - Intronic
995871599 5:116749362-116749384 CATTTGGAATAACTTATACCAGG + Intergenic
998144162 5:139716761-139716783 CAACTGGAGCAGCTAAGACCAGG + Intergenic
1010016180 6:71107036-71107058 CAGTTGGCACCTCTCATACCCGG - Intergenic
1010033412 6:71292611-71292633 CAATTGAAACAACTTATACATGG - Intronic
1010598142 6:77790221-77790243 CAAGTGGAACATCACACACCAGG + Intronic
1010876368 6:81112230-81112252 GAATTGGAACATCACACACCAGG - Intergenic
1011142821 6:84178832-84178854 GAAGGGGAACAGCACATACCAGG - Intronic
1014952964 6:127580428-127580450 CAAGTGGAACACCTTTTACCAGG + Exonic
1035752417 8:2005574-2005596 GAATTGGAAAAGGTCCTACCTGG - Exonic
1035911258 8:3569104-3569126 CAATTGGAACAGCTCATACCAGG - Intronic
1036800705 8:11789010-11789032 CATTTGCAGCAGCTCATGCCTGG - Intergenic
1041912447 8:63103265-63103287 CAATGGGCACAGCCCATTCCCGG - Intergenic
1043975147 8:86576600-86576622 CAAATGGAAAAGATCATACTAGG - Intronic
1045373074 8:101544504-101544526 CAAAAGGAGCAGGTCATACCAGG - Intronic
1049573543 8:143380387-143380409 CACTGGGAGCAGCTCATCCCTGG + Intronic
1051022637 9:12563176-12563198 CAATTATAACAGCTCAAACTGGG - Intergenic
1185627668 X:1493883-1493905 CAAATGGCACAGCTCCTGCCTGG + Intronic
1190213688 X:48466879-48466901 CAGGTGGCACAGCTCAGACCTGG + Intronic
1193591231 X:83390940-83390962 CCATTGGAACAACTCATAACAGG + Intergenic
1201849603 Y:18463359-18463381 CATTTGAAACATCTCATTCCTGG + Intergenic
1201862299 Y:18612154-18612176 CAATTGTATCATCTCATTCCTGG + Intergenic
1201871024 Y:18708226-18708248 CAATTGTATCATCTCATTCCTGG - Intergenic
1201883715 Y:18857016-18857038 CATTTGAAACATCTCATTCCTGG - Intergenic
1202164232 Y:21969571-21969593 CAATTGTATCATCTCATTCCTGG - Intergenic
1202227124 Y:22616801-22616823 CAATTGTATCATCTCATTCCTGG + Intergenic
1202315998 Y:23578853-23578875 CAATTGTATCATCTCATTCCTGG - Intergenic
1202334137 Y:23789264-23789286 CAATTGTAACATCTCATTCCTGG - Intergenic
1202350464 Y:23984964-23984986 CAGTTGCAACATCTCATTCCTGG - Intergenic
1202520315 Y:25685157-25685179 CAGTTGCAACATCTCATTCCTGG + Intergenic
1202536631 Y:25880795-25880817 CAATTGTAACATCTCATTCCTGG + Intergenic
1202554767 Y:26091214-26091236 CAATTGTATCATCTCATTCCTGG + Intergenic