ID: 1035912596

View in Genome Browser
Species Human (GRCh38)
Location 8:3584009-3584031
Sequence GAGGTGTTTTTATAGTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035912596 Original CRISPR GAGGTGTTTTTATAGTGGAT GGG (reversed) Intronic
904911115 1:33935256-33935278 GAGGTGTTTTTCTGGGGGAGGGG + Intronic
906620485 1:47273890-47273912 CATGTGTATTTATAGTGGTTTGG + Intronic
908880538 1:68726863-68726885 GAGATATTTTTAAAGGGGATAGG - Intergenic
910914947 1:92278672-92278694 GAGGGATTTTTAGAGAGGATGGG - Intronic
915090742 1:153422894-153422916 ATGGTGTTTTTATAGTGGCAGGG - Exonic
915730503 1:158050469-158050491 GAGGGATGTTTATAGTGAATGGG - Intronic
919005886 1:191899074-191899096 GAGATGTTTTTTTTCTGGATTGG - Intergenic
920203060 1:204272273-204272295 GAGGTGCTGTTAGACTGGATGGG - Intronic
924388596 1:243525388-243525410 GATGTCTTTTTCTAGTGTATGGG - Intronic
1063612392 10:7573832-7573854 GAGATGTATTTATAGGGGAAGGG + Intronic
1064898279 10:20263386-20263408 CAGGTGTTTTTATAGTTTTTTGG - Intronic
1064933417 10:20652743-20652765 GATGTGTCTTTATAGTAGAACGG + Intergenic
1074719583 10:116252960-116252982 GAGATGTTTTTATATTGGCCGGG - Intronic
1075497068 10:122931219-122931241 GAGGTCTTTTTAAAGTCGTTTGG + Intronic
1075537070 10:123280190-123280212 GATTTATTTTTATAATGGATTGG - Intergenic
1077848230 11:6048739-6048761 TTAGTGATTTTATAGTGGATTGG - Intergenic
1079499764 11:21089912-21089934 GAGGTGCTTTTATTGTGGTTAGG + Intronic
1081986195 11:47306134-47306156 GTACTGTTTTCATAGTGGATAGG + Intronic
1082707493 11:56510291-56510313 GAAGCATTTTTAGAGTGGATAGG - Intergenic
1087800702 11:102500561-102500583 TATGTGTTTTTATAATGGACAGG - Intergenic
1090097040 11:123752553-123752575 GAGGTTTATATATAGTGGAAGGG - Intergenic
1090273242 11:125402388-125402410 GAGGTGTCTCTCTAGTGGAATGG - Intronic
1092486345 12:8905521-8905543 AAGTTGTTGTTATAGTGAATTGG + Intergenic
1097294017 12:57943750-57943772 TAGCTGTTTTTACAGTGGAAGGG + Intronic
1097481917 12:60138371-60138393 TACGTGTTTTAATAGTGGAAGGG - Intergenic
1100180935 12:92085751-92085773 GAGCTGTATTTATAATGGAATGG - Intronic
1102402862 12:112645867-112645889 GAGGTGGTTTTATAGAAGAGTGG + Intronic
1105256551 13:18747086-18747108 GAGGTGATTTAATCTTGGATGGG - Intergenic
1105256979 13:18750167-18750189 GAGGTGATTTAATCATGGATGGG - Intergenic
1105259658 13:18769542-18769564 GAGGTGATTTAATCATGGATGGG - Intergenic
1105262334 13:18788859-18788881 GAGGTGATTTAATCATGGATGGG - Intergenic
1105803069 13:23926778-23926800 GAGGTGTTTTTAGCGTTTATAGG + Intergenic
1109451083 13:62515052-62515074 GACCTGTTTTTTTAGGGGATGGG + Intergenic
1109776387 13:67046319-67046341 AAGATGTTTTTAGATTGGATTGG + Intronic
1110561196 13:76912291-76912313 GAGTTGTTTTAATAGTTGTTGGG + Intergenic
1111785074 13:92776388-92776410 CAGGGGTTTTTATAATGGAAAGG - Intronic
1112717562 13:102204387-102204409 GAGGTGTGGTTACAGTGGGTGGG - Intronic
1122445897 14:101768213-101768235 AAGGTGTCTTTATAGTGCAGTGG - Intronic
1124698104 15:31884113-31884135 GATGTATTTTTATATTTGATAGG + Intergenic
1126699711 15:51357023-51357045 TAGGTGTTTTGATAGTTAATGGG + Intronic
1129691091 15:77714023-77714045 GAGAGGTCTTTATAGGGGATGGG - Intronic
1131890752 15:96969332-96969354 GAGGCCTTTTTATGGTGGAGCGG - Intergenic
1132206762 15:99991695-99991717 CATGTGTCTTTATAGTGGAATGG - Intronic
1134229551 16:12418389-12418411 AAGCTGTTTTTCTAGTGGAGTGG + Intronic
1134773849 16:16834621-16834643 GAAGTGTTTTTATAATAGAATGG - Intergenic
1135950424 16:26909308-26909330 GAGGTGTTTTTATCATAGAAAGG + Intergenic
1137743154 16:50800757-50800779 GAGGTCTTTTTAAAGTAGGTAGG + Exonic
1138882887 16:61037475-61037497 GCAGTGTTTTTATAGTGTAGGGG - Intergenic
1140881331 16:79200512-79200534 CAGGTGTTATTGTAGTGGAGGGG - Intronic
1141102321 16:81207027-81207049 GAGGTGCTTCTATATGGGATGGG - Intergenic
1143931367 17:10430927-10430949 GAGGTTTTTTTTTCATGGATGGG + Intergenic
1144480496 17:15625114-15625136 GAGGTGTTTGGATAATGGGTTGG - Intronic
1144917814 17:18738631-18738653 GAGGTGTTTGGATAATGGGTTGG + Intergenic
1150502140 17:65660970-65660992 GAAGTGTTTTTATATGGGAGTGG - Intronic
1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG + Exonic
1154221686 18:12460312-12460334 GAGGTGCCTTTAGACTGGATGGG + Intronic
1154425853 18:14271601-14271623 GAGGTGATTTAATCATGGATCGG + Intergenic
1154426370 18:14275270-14275292 GAGGTGATTTAATCATGGATGGG + Intergenic
1154429111 18:14294855-14294877 GAGGTGATTTAATCATGGATGGG + Intergenic
1154431383 18:14311199-14311221 GAGGTGATTTAATCATGGATGGG + Intergenic
1154434060 18:14330505-14330527 GAGGTGATTTAATCATGGATGGG + Intergenic
1154434490 18:14333593-14333615 GAGGTGATTTAATCTTGGATAGG + Intergenic
1157847983 18:51021491-51021513 GAGGTGTTCTAATACTTGATTGG + Intronic
1158447381 18:57533028-57533050 GGGATGTTTTAAAAGTGGATGGG - Intergenic
1158804806 18:60957837-60957859 TAAGTGTTTTTATAGTGAAAGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929633457 2:43491135-43491157 TAGCTTTATTTATAGTGGATGGG - Intronic
934492039 2:94767999-94768021 GAGGTGATTTAATCATGGATGGG - Intergenic
937219231 2:120332178-120332200 GAGGTGTATTTATTTTGGTTTGG + Intergenic
938279899 2:130056378-130056400 GAGGTGATTTAATCATGGATGGG - Intergenic
938330851 2:130447093-130447115 GAGGTGATTTAATCATGGATGGG - Intergenic
938359095 2:130674410-130674432 GAGGTGATTTAATCATGGATGGG + Intergenic
938435492 2:131281059-131281081 GAGGTGATTTAATCATGGATGGG + Intronic
938999414 2:136716733-136716755 GATGTGTTTCTATAGTGTTTTGG - Intergenic
939249495 2:139666307-139666329 TAATTGTTTTTATAGAGGATGGG + Intergenic
939849556 2:147288268-147288290 GAGGTGTTTTTGTAGTTTGTGGG - Intergenic
944632352 2:201640060-201640082 GAAGTGCTTTTATAATGGAAAGG + Intronic
945897789 2:215504127-215504149 AAGGTGTTTTTCTAGTGGCATGG - Intergenic
1169700215 20:8437725-8437747 GTGGTATTTTTATATTGAATAGG - Intronic
1171323884 20:24273541-24273563 GAGGGGTGTTTATAGTAGTTAGG - Intergenic
1176842547 21:13852114-13852136 GAGGTGATTTAATCTTGGATGGG - Intergenic
1176848397 21:13894119-13894141 GAGGTGATTTAATCATGGATGGG - Intergenic
1177124041 21:17173404-17173426 GAGGTGTGTTTTTAATTGATGGG + Intergenic
1179828768 21:43983071-43983093 CATCTGTTTTTAAAGTGGATGGG + Exonic
1183054123 22:35291405-35291427 CAGGGGTTTTTACAGTGGAAAGG + Intronic
1184945444 22:47800198-47800220 TAGGAGTTTTTATAATGAATGGG - Intergenic
949298128 3:2550623-2550645 GATGTGTCTTTATAGTAGAATGG - Intronic
950567215 3:13777138-13777160 AAGGTGTTTTTATAATGACTAGG + Intergenic
955914407 3:63892349-63892371 GAGGTGTCTTTAAAGTTGACTGG - Intronic
957573108 3:81974034-81974056 GAGATATTTTTAAAGTGCATTGG - Intergenic
957587005 3:82145880-82145902 GAGGTGTTTCTGTAGGAGATTGG + Intergenic
959010588 3:101070998-101071020 GAGGCCATTTTGTAGTGGATAGG - Intergenic
959767412 3:110048156-110048178 GCTGTGTTGTTTTAGTGGATGGG + Intergenic
959879556 3:111427933-111427955 GAGGTGTTTGGATTATGGATAGG + Intronic
960354501 3:116634657-116634679 AAGGGGTTTTTAGACTGGATAGG + Intronic
963011522 3:140775040-140775062 CAGTTCTTGTTATAGTGGATGGG - Intergenic
965389882 3:168092324-168092346 TAGATATTTTTATAGTGGAAGGG + Intronic
970692104 4:18631504-18631526 GAGAAGTTTATATAATGGATGGG + Intergenic
971045825 4:22804030-22804052 GAGGTGTTTTTGTGGTGTAGTGG + Intergenic
973366965 4:49215671-49215693 GAGGTGATTTAATCTTGGATGGG - Intergenic
974508982 4:62812213-62812235 GAATTGTTTTTGAAGTGGATGGG + Intergenic
976088433 4:81429957-81429979 GAGATGTTTTTACACTGGAGTGG - Intronic
976997240 4:91450114-91450136 GATTTGTTTTTATACAGGATGGG + Intronic
977841651 4:101714423-101714445 GATGTGGTCTCATAGTGGATTGG - Intronic
978264359 4:106804742-106804764 CAGGTCTTTCTATATTGGATTGG - Intergenic
978763916 4:112384828-112384850 GAGATTTTTTTTTATTGGATTGG - Intronic
985801057 5:2005491-2005513 GAGGTGGTTTCCTAGAGGATCGG + Intergenic
990154218 5:52856476-52856498 AAGGTGTTTTTATAGTGGATGGG - Intronic
991773935 5:70065805-70065827 GAGCAGTTTTTATAGTGCAGGGG + Intronic
991853229 5:70941229-70941251 GAGCAGTTTTTATAGTGCAGGGG + Intronic
993806908 5:92422293-92422315 GATGTGTTTTTATTGAGGAAAGG - Intergenic
994438551 5:99770067-99770089 CACGTGTTTTTATAGTAGAATGG - Intergenic
995292798 5:110478000-110478022 TAGGTGTTATTATAGTGGAAAGG + Intronic
996904920 5:128587974-128587996 CAGGTGTTTTAATATTGGACAGG - Intronic
1004263232 6:14126725-14126747 GAGCTGTTTTTATGATGAATGGG + Intronic
1004953624 6:20702518-20702540 GAGATGGTTTTCTTGTGGATTGG + Intronic
1005065810 6:21816534-21816556 GAGGTGTTTGTAAAGAGGAGGGG + Intergenic
1005274714 6:24204160-24204182 CATGTGTCTTTATAGTAGATTGG - Intronic
1005432756 6:25775617-25775639 GAGGTCTTGTTATATTGGCTAGG + Intronic
1006123952 6:31825599-31825621 GAGGTGTTTTGATAGTGGACAGG + Intergenic
1012621092 6:101344832-101344854 TAAGTGTTTTTGTAGTGGAAAGG + Intergenic
1018883831 6:167914820-167914842 GAGGTGTTTTTAAAATAAATGGG + Intronic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1023166502 7:37348523-37348545 GTGGTGTGTTTATAGTTGAGTGG + Intronic
1031554322 7:123153394-123153416 GAGGAGTTTTTGAAGTGGAATGG + Intronic
1032559829 7:132877625-132877647 GAGGTTTTATTAAAGTGGCTTGG - Intronic
1032848402 7:135771489-135771511 AAGGTCATTTGATAGTGGATGGG - Intergenic
1033078809 7:138275068-138275090 TAGGAGTTTTTATCGTGAATGGG - Intergenic
1033474934 7:141682789-141682811 AAGGTGGTATTATATTGGATAGG - Intronic
1035912596 8:3584009-3584031 GAGGTGTTTTTATAGTGGATGGG - Intronic
1037001242 8:13721870-13721892 CATGTGTCTTTATAGTAGATTGG + Intergenic
1044294597 8:90512641-90512663 GAGGTGTTTTGATTGTGCACAGG + Intergenic
1046534316 8:115489022-115489044 AAGGTGTTATTATAATGGAGTGG - Intronic
1051712005 9:19940727-19940749 AAGGTGATTTTATATGGGATGGG + Intergenic
1052376091 9:27718993-27719015 GAGATGTTTGTTGAGTGGATAGG + Intergenic
1052877985 9:33581709-33581731 GAGGTGATTTAATCCTGGATGGG + Intergenic
1053665972 9:40317908-40317930 GAGGTGATTTAATCATGGATGGG + Intronic
1053915553 9:42942953-42942975 GAGGTGATTTAATCATGGATGGG + Intergenic
1054377128 9:64457936-64457958 GAGGTGATTTAATCATGGATGGG + Intergenic
1054518638 9:66058375-66058397 GAGGTGATTTAATCATGGATGGG - Intergenic
1056586358 9:87929935-87929957 GAGGTGATTTAATCATGGATGGG - Intergenic
1056610522 9:88123008-88123030 GAGGTGATTTAATCATGGATGGG + Intergenic
1057676184 9:97137690-97137712 GAGGTGATTTAATCATGGATGGG - Intergenic
1060957284 9:127651435-127651457 GAGCTATTTTTATGGTGGGTTGG + Intronic
1187979622 X:24741736-24741758 GATGTGTCTTTTTAGTGGAATGG + Intronic
1189767528 X:44386990-44387012 AAGGTGTTTTTCTAGTGTAATGG + Intergenic
1191052850 X:56212943-56212965 GAGGTGGTGTTATATTAGATTGG + Intergenic
1194047395 X:89025086-89025108 GAGTTGTTTCTATAGTGTAGTGG + Intergenic
1195301766 X:103536695-103536717 GAGGTGTCCATAAAGTGGATAGG - Intergenic
1195464628 X:105166873-105166895 GTTGTGTTTTTAAAGTGGAGTGG + Intronic
1197712843 X:129684326-129684348 GAGCTTTTATTCTAGTGGATGGG + Intergenic