ID: 1035914980

View in Genome Browser
Species Human (GRCh38)
Location 8:3609009-3609031
Sequence TATGCAGGACCGCTGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035914980_1035914985 27 Left 1035914980 8:3609009-3609031 CCCCTTTCCAGCGGTCCTGCATA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1035914985 8:3609059-3609081 ATCTGTGTTACAAACTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035914980 Original CRISPR TATGCAGGACCGCTGGAAAG GGG (reversed) Intronic
902253782 1:15174068-15174090 TTTGCAGTTCCGCTGGAAGGAGG + Intronic
902520449 1:17012731-17012753 TCTCCAGGACCTCTGGACAGAGG + Intergenic
915940826 1:160117268-160117290 GATGCAGGACCTCTGAGAAGAGG + Intronic
919240848 1:194914365-194914387 TAGGAAGGAGAGCTGGAAAGGGG - Intergenic
922891106 1:229062489-229062511 CATGCAGGAGCACTGGGAAGGGG + Intergenic
1062831666 10:609891-609913 TAGGAAGAACCGCTGGGAAGGGG - Intronic
1068183821 10:53558639-53558661 TATTCAGAACAGCTGAAAAGGGG + Intergenic
1070267880 10:74921936-74921958 TGTGCAAGACAGCTGGCAAGGGG - Intronic
1076752573 10:132550972-132550994 TCTGCAGGCCACCTGGAAAGGGG + Intronic
1077712844 11:4553469-4553491 TTTAGAGGACCTCTGGAAAGCGG + Intergenic
1077965935 11:7133533-7133555 TATGCAGGACCTCAAGAAAGGGG + Intergenic
1078845312 11:15114668-15114690 TCTGCAGGAGCGCTGGAATGGGG - Intronic
1080847143 11:36036368-36036390 GAAGCAGGACTGCTGGCAAGAGG - Intronic
1082897919 11:58212823-58212845 TGTGCAGGACTACTGGTAAGTGG + Intergenic
1084687727 11:70706863-70706885 TAAGCAGGGCTGCTGGAAAGAGG + Intronic
1086255490 11:84871221-84871243 TATGCAGGAAGCCTGGAAAAGGG - Intronic
1088263005 11:107962273-107962295 TATTCAGGATGGCTGGGAAGGGG + Exonic
1088776846 11:113093546-113093568 TATGAAGCACAGCTGGATAGAGG + Intronic
1094847642 12:34368352-34368374 TAGGCAGGAAGGCTTGAAAGGGG - Intergenic
1094852272 12:34387599-34387621 TTTGCAGGAATGCTTGAAAGTGG - Intergenic
1096595678 12:52693514-52693536 TGTGCAGGACCGTGGGACAGAGG + Intronic
1098086605 12:66851265-66851287 TACACAGGACATCTGGAAAGTGG + Intergenic
1098093844 12:66933252-66933274 TATGCAGCTCCTCTGGGAAGAGG - Intergenic
1107465794 13:40648961-40648983 TGTGCAGGTCTGCGGGAAAGTGG + Intronic
1111450092 13:88404147-88404169 AATGCAGGACCTCTGGAGAGGGG + Intergenic
1113484350 13:110643376-110643398 GACGCCGGACTGCTGGAAAGGGG + Intronic
1117501242 14:56353781-56353803 TATACTGGACCCCTGGAAAGTGG - Intergenic
1117515720 14:56499369-56499391 TAGGGAGGACCTCTGGAATGAGG + Intronic
1117581773 14:57158353-57158375 TATGAGGAACCGATGGAAAGTGG - Intergenic
1125426681 15:39555975-39555997 AATGCAGGACCGCTTGAGAAGGG + Intergenic
1125793383 15:42386648-42386670 TATACAGGAGCCCTGGACAGGGG - Intronic
1129350684 15:74954490-74954512 TCAGCAGCACCCCTGGAAAGGGG - Exonic
1132491100 16:231562-231584 TATACAGAACTGCTGGACAGAGG - Intergenic
1148166921 17:45490386-45490408 TAAGCAAGACCGCTGGTGAGGGG + Intronic
1149356714 17:55846546-55846568 TATGAAGGACAGGTGGAAGGTGG + Intergenic
1150398100 17:64836790-64836812 TAAGCAAGACCGCTGGTGAGGGG + Intergenic
925082110 2:1078535-1078557 GCTGCAGGACAGCTGGACAGGGG + Intronic
925149422 2:1605060-1605082 CAGACAGGACGGCTGGAAAGTGG + Intergenic
925800984 2:7600046-7600068 TAGGCAGGAGGGCTGGAAAAGGG - Intergenic
928370540 2:30737114-30737136 TTTGCTGGACCCCTGCAAAGCGG - Intronic
933110730 2:78397140-78397162 CATGCAGGTCCGCAGGGAAGTGG - Intergenic
935350261 2:102146503-102146525 TCTGCAGGACAGCTGGCATGGGG + Intronic
942084181 2:172428470-172428492 CATGCAGGACACATGGAAAGTGG - Intronic
948245528 2:236481040-236481062 TATGCAGGAAGGCTGGCTAGTGG + Intronic
1172367894 20:34363691-34363713 TAGGCCGAACCGCTGGAGAGTGG - Intronic
1173724425 20:45287317-45287339 TATAGAGGACACCTGGAAAGGGG - Intergenic
1174446495 20:50594552-50594574 TACCCAGGACAGCTGGAAATAGG - Exonic
1175719356 20:61276033-61276055 TATGCAGGAGCACTGCAGAGCGG + Intronic
1175801949 20:61805967-61805989 TACGCAGGCCCGCTGGGAGGTGG + Intronic
1176684850 21:9838543-9838565 TTTACAGGACCCCTGCAAAGAGG + Intergenic
1177522379 21:22243383-22243405 TATTCATGAACACTGGAAAGAGG - Intergenic
1183006617 22:34908216-34908238 TATTAAGTAACGCTGGAAAGAGG - Intergenic
949306941 3:2652349-2652371 TATGTAGTACCAGTGGAAAGTGG + Intronic
953634697 3:44652818-44652840 TGTCCAGGAAAGCTGGAAAGAGG + Intronic
954324479 3:49855836-49855858 TCAGCAGGACCCCTGGATAGGGG + Intronic
954602127 3:51878085-51878107 CTTGCAGGACGGCTGGAAAAAGG + Intergenic
955112975 3:55967695-55967717 TATGCAGCAATGCTGGAAGGTGG + Intronic
955213560 3:56964427-56964449 TCAGCTGGACTGCTGGAAAGAGG - Intronic
962451959 3:135527230-135527252 TCTACAGCACTGCTGGAAAGTGG - Intergenic
962741413 3:138364928-138364950 GATCCAGGAGTGCTGGAAAGAGG - Intronic
964106183 3:153042437-153042459 TTTGCAGAACCCCTGCAAAGGGG - Intergenic
969202798 4:5619039-5619061 TATGTAGGACCAATGGACAGAGG + Intronic
969516352 4:7650390-7650412 TATCCAGGCACGCTGCAAAGTGG - Intronic
969736981 4:8998590-8998612 TATGCAGGATCACTGGACACAGG - Intergenic
975592062 4:76010773-76010795 TATGCAGGAGGGCAGGAATGAGG - Intergenic
976053337 4:81032697-81032719 TATGCAAGACTCCTGGAAAAAGG + Intronic
976933174 4:90593992-90594014 TATGCAGGCCCATTGTAAAGTGG + Intronic
981718514 4:147775786-147775808 TATGCAGCACATCTGGATAGTGG + Intronic
982702139 4:158669503-158669525 TATACAGAACTGCTGGACAGAGG + Exonic
986669766 5:10132511-10132533 GGTGGAGGACAGCTGGAAAGAGG + Intergenic
987987332 5:25163886-25163908 TATGCTGTACTGCTGGAAAATGG - Intergenic
991926209 5:71707431-71707453 TATGCAGGTCCCCAGGTAAGTGG - Intergenic
999452223 5:151686913-151686935 TCTGAAGGACCGCGGGAATGTGG + Exonic
1000012848 5:157248986-157249008 TATGAATCACTGCTGGAAAGAGG + Exonic
1003083410 6:3040936-3040958 TTTGCAGGACCTTAGGAAAGAGG - Intergenic
1006153790 6:32003289-32003311 TAGGCAGGTCCGGTGGGAAGGGG - Intergenic
1006160098 6:32036026-32036048 TAGGCAGGTCCGGTGGGAAGGGG - Intergenic
1009767058 6:68091856-68091878 TATGCAGGAACGCAGGGTAGCGG - Intergenic
1011790221 6:90890886-90890908 ATTGCAGGAATGCTGGAAAGAGG - Intergenic
1012627906 6:101426877-101426899 CACAGAGGACCGCTGGAAAGGGG - Intronic
1014717678 6:124885662-124885684 TCTGCAAGCCCGGTGGAAAGTGG + Intergenic
1016894313 6:149037493-149037515 CAGGCAGGACCCCTGGAATGAGG + Intronic
1017976105 6:159358784-159358806 TATGCAGAACAGCTGAAGAGGGG - Intergenic
1018023996 6:159789801-159789823 GATGTTGGACCGCTGGGAAGAGG + Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1031622597 7:123952980-123953002 TATGGCAGACCGCTAGAAAGTGG + Intronic
1035370792 7:158377696-158377718 TACGCACGACAGCTGAAAAGTGG + Intronic
1035914980 8:3609009-3609031 TATGCAGGACCGCTGGAAAGGGG - Intronic
1054452497 9:65410679-65410701 AAGGCAGGACCACTGGAAGGAGG + Intergenic
1055238631 9:74156805-74156827 TATGCAGTTCCTCTGGATAGTGG - Intergenic
1057197132 9:93121425-93121447 CCTGCAGGGCAGCTGGAAAGGGG + Intergenic
1057730296 9:97602588-97602610 TATGCAAGACAGCTTTAAAGAGG - Exonic
1057920567 9:99093411-99093433 CATGGAGGACAGCTGGTAAGAGG + Intergenic
1187249383 X:17583124-17583146 TATGCAAGATCATTGGAAAGTGG - Intronic
1188538489 X:31223110-31223132 TATTCAGGTCAGCTGAAAAGAGG + Exonic
1200827338 Y:7658524-7658546 TCAGCAGGAGAGCTGGAAAGGGG + Intergenic
1202161641 Y:21940939-21940961 TAAGCAGGACAGCTGAGAAGGGG + Intergenic
1202229715 Y:22645434-22645456 TAAGCAGGACAGCTGAGAAGGGG - Intergenic
1202313441 Y:23550731-23550753 TAAGCAGGACAGCTGAGAAGGGG + Intergenic
1202557362 Y:26119864-26119886 TAAGCAGGACAGCTGAGAAGGGG - Intergenic