ID: 1035917867

View in Genome Browser
Species Human (GRCh38)
Location 8:3644631-3644653
Sequence CCCTCTTTACTGAAGGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035917867_1035917871 -7 Left 1035917867 8:3644631-3644653 CCTATTACCTTCAGTAAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1035917871 8:3644647-3644669 AAGAGGGCAGCAGGTTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035917867 Original CRISPR CCCTCTTTACTGAAGGTAAT AGG (reversed) Intronic
908335024 1:63113712-63113734 CCCTCTTTTCAAAAGGTTATTGG + Intergenic
908890461 1:68841408-68841430 TCCTCTTTACTGAAGAAAAGAGG - Intergenic
911863932 1:102991892-102991914 CTCTCTGTACTGAATGTGATTGG + Intronic
912041667 1:105398264-105398286 CTCTCTTTCCTTTAGGTAATAGG - Intergenic
914977782 1:152381456-152381478 CTCTCTTTCCTGCAGGTAAGAGG - Intergenic
915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG + Intergenic
917771383 1:178283356-178283378 CCCTCTTCTCTGAAGGTCATAGG + Intronic
921693617 1:218181635-218181657 TTCTCTTTAATGAAGGTCATGGG - Intergenic
923083307 1:230681012-230681034 GCCTTTTTCCTGAAGGTGATTGG - Intronic
1063301726 10:4854949-4854971 CCCTCTTTGCTGATGGCTATGGG + Intergenic
1068521266 10:58080110-58080132 CCATCTCTACTGAAGTCAATAGG + Intergenic
1069968362 10:72142044-72142066 CCCTGTTTTCTGATTGTAATGGG + Intronic
1072239565 10:93482988-93483010 CCATTTTCACTGAAGGCAATTGG - Intergenic
1072748364 10:97958095-97958117 CCTTCTCTACTGAGGTTAATAGG + Intronic
1073753480 10:106556383-106556405 TCCTCTTGACTGAAGGAAAGGGG - Intergenic
1073935938 10:108631967-108631989 CTCTCTTTACTCAAGCTAAAAGG + Intergenic
1076193552 10:128499369-128499391 ACCTCTTTGCTGAAGGTCGTTGG - Intergenic
1079019407 11:16896716-16896738 TCCTTTTTCCAGAAGGTAATGGG - Intronic
1080169722 11:29285568-29285590 GCCACTTTACTGAAGGTTACAGG + Intergenic
1080994185 11:37580257-37580279 CCCTCCTTACTCAAGGCAAATGG - Intergenic
1081610947 11:44563130-44563152 CCATCCCTACTGAAGTTAATAGG - Intergenic
1082756748 11:57084124-57084146 CCCTCTTTACTGATCTTGATTGG + Intergenic
1090455446 11:126844751-126844773 CACTCTTTGCTGAAGGCTATGGG + Intronic
1091651204 12:2311465-2311487 CACTGTTTTCTGAAGGTAAAGGG - Intronic
1094191589 12:27703714-27703736 CCCAGTTTACTGAAGGCAAAGGG - Intergenic
1095977977 12:47952618-47952640 CCCTCCCTACTGAAGTGAATAGG - Intergenic
1096862141 12:54537163-54537185 CACTCTTTACTGAATGAATTAGG - Intronic
1099655412 12:85483232-85483254 GCCTCTTTAAAGAAGGTATTCGG - Intergenic
1102173254 12:110858201-110858223 TCCTCATTACTGGAGATAATTGG + Intronic
1106126606 13:26904897-26904919 CCATCCCTACTGAAGTTAATAGG + Intergenic
1106797178 13:33218513-33218535 CCATCTCTACTGAAGTGAATAGG + Intronic
1108890520 13:55252579-55252601 TCTTCCTTATTGAAGGTAATTGG + Intergenic
1109152349 13:58860418-58860440 CTCTCTTTCCTGCAGGTAAGAGG - Intergenic
1110755717 13:79171698-79171720 TCCTCTTGACAAAAGGTAATAGG + Intergenic
1119858063 14:77915869-77915891 CCCACTTTACAAAAGGTAACTGG - Intronic
1120744772 14:88143360-88143382 CTCTCTTTCCTGCAGGTAAGAGG + Intergenic
1121483625 14:94296831-94296853 TGCTCTTTACTAAAGGTAAGTGG + Intergenic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1126604988 15:50467462-50467484 CTCTCTTAACTGAAGGGAACAGG + Intronic
1128583962 15:68831199-68831221 CCATTTTTAGTGAAGGTACTTGG + Intronic
1129131210 15:73498303-73498325 TCCTCTTTGCTGTAGGTATTTGG + Intronic
1135566077 16:23512085-23512107 CCATCCCTACTGAAGTTAATAGG - Intronic
1138173944 16:54878821-54878843 GACTCCTTACTAAAGGTAATAGG + Intergenic
1144448289 17:15352327-15352349 TCCTCATTACTCAAGGTAATGGG + Intergenic
1146471718 17:33130138-33130160 CCTTCTCTACTGAGGTTAATAGG + Intronic
1148490489 17:48020749-48020771 GCCTGTGTTCTGAAGGTAATAGG - Intergenic
1159788465 18:72744793-72744815 GCCACTTTAATCAAGGTAATAGG + Intronic
1160488248 18:79312867-79312889 CCCTCTTTTCAGAAAGTAATTGG + Intronic
1165718468 19:38062412-38062434 CCCACTTTACAGAAGGGAACAGG - Intronic
933141366 2:78795243-78795265 CTCTCTTTCCTGAAGGTAAAAGG - Intergenic
934903268 2:98177680-98177702 CCCCCTTTTCAGATGGTAATTGG + Intronic
941869216 2:170366198-170366220 CCATCCCTACTGAAGTTAATAGG + Intronic
942926425 2:181438820-181438842 CCCACTTTATTGAAAGTATTTGG + Intergenic
945388839 2:209238954-209238976 CCCTGTTTACTGTAGGAACTTGG + Intergenic
947843024 2:233220829-233220851 CCATCCCTATTGAAGGTAATAGG + Intronic
1169598732 20:7231563-7231585 CCCTTTAGACTGAATGTAATTGG - Intergenic
1170081851 20:12485149-12485171 CATTCTTTACACAAGGTAATAGG - Intergenic
1175791077 20:61740197-61740219 CCCTCTTTACTTAGGCTACTGGG - Intronic
1178201722 21:30414642-30414664 CCCTCTTTGCTGATGGCCATGGG + Intronic
1180054149 21:45348614-45348636 TCATCGTTACTGAAGGTCATAGG + Intergenic
1182855988 22:33518033-33518055 CCCTCTCTTCTCAAGGCAATGGG + Intronic
1182975652 22:34621821-34621843 CCCTCCATAGTGAAGGTAAAAGG - Intergenic
1183241831 22:36663368-36663390 CCCTCTATACTCAGGGAAATTGG + Intronic
951932239 3:27981568-27981590 ACCTCATTACTGCAGGTATTAGG - Intergenic
952171064 3:30807652-30807674 CCCTCTTTGCTTAAGGAAACTGG - Intronic
954176734 3:48850841-48850863 CCATCCCTACTGAAGTTAATGGG - Intergenic
954610108 3:51940442-51940464 CCCTCATTTCTGCAGGTGATGGG - Intronic
955558640 3:60164585-60164607 CCATCATTATTGAAAGTAATTGG + Intronic
955963726 3:64366607-64366629 CCCACATTATAGAAGGTAATAGG + Intronic
956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG + Intronic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959947108 3:112136893-112136915 TCTTTTTTTCTGAAGGTAATAGG - Intergenic
961426932 3:126855764-126855786 CCATCCCTACTGAAGTTAATAGG - Intronic
961510841 3:127402565-127402587 GACTCTTTGCTGATGGTAATGGG - Intergenic
962067727 3:132000030-132000052 GCCCCTATACTGAAGGAAATAGG + Intronic
963947024 3:151156919-151156941 CCCTCTTTAATCAAGATAACAGG - Intronic
967007894 3:185401576-185401598 GCCGCTTTACTGAAGTAAATAGG - Intronic
972292978 4:37707833-37707855 CCATCCCTACTGAAGTTAATAGG + Intergenic
972431714 4:38989471-38989493 CCCTCTTTCCACAGGGTAATAGG + Intronic
972917937 4:43903862-43903884 CTCTCTTTTCTGCAGGTAAGAGG + Intergenic
974417636 4:61630346-61630368 CTCTTTTTACTGCAAGTAATAGG + Intronic
975485811 4:74933356-74933378 GCATCTTAACTGCAGGTAATTGG + Exonic
976978577 4:91194924-91194946 CCCTATTTACAAAAAGTAATTGG + Intronic
978795948 4:112707097-112707119 ACCTCTTTACCGAAGAGAATTGG + Intergenic
981677262 4:147356792-147356814 TACTCTTTACAGTAGGTAATAGG + Intergenic
983529467 4:168794348-168794370 CCCACTTCACTGAAGGTGAGGGG + Intronic
985054034 4:186020462-186020484 CCTACTTTACTGAAGGTCTTGGG + Intergenic
990141235 5:52706703-52706725 CCATCCCTACTGAAGTTAATAGG - Intergenic
990963323 5:61417636-61417658 CCATCATTACTGTAGCTAATCGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000359805 5:160436384-160436406 CCCTCTTCACTGATGCTGATGGG + Intergenic
1003384272 6:5652833-5652855 CCCTCCTGGCTGCAGGTAATGGG + Intronic
1004382636 6:15145903-15145925 GCCTCTTAATAGAAGGTAATAGG - Intergenic
1004400794 6:15286877-15286899 GCCTCTTAATAGAAGGTAATAGG + Intronic
1006795191 6:36727718-36727740 CCCTCTTGACTGGAGGGACTGGG - Intronic
1008001772 6:46367561-46367583 CCATCTTGACTGAAAATAATGGG - Intronic
1009605539 6:65862639-65862661 TCCTCTTTAATGATGGAAATTGG + Intergenic
1010208394 6:73343240-73343262 CCATCCTTACTGAAGTTAATAGG + Intergenic
1010372957 6:75133321-75133343 CCGTTTATACTGAAGGTGATGGG - Exonic
1014701581 6:124695691-124695713 CCTTTTTCACTTAAGGTAATAGG - Intronic
1020479624 7:8642132-8642154 CCCTTTTTAAGGAAGCTAATTGG - Intronic
1020837776 7:13176001-13176023 GCCTCTTTCCTGTTGGTAATGGG + Intergenic
1022346142 7:29516400-29516422 CCATCCCTACTGAAGTTAATAGG + Intergenic
1026462616 7:70628440-70628462 TACTTTTTCCTGAAGGTAATAGG + Intronic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1033514410 7:142092114-142092136 TCCTCTTGACTGAAGGTCAGTGG - Intronic
1033936535 7:146592738-146592760 CCATCCTTATTGAAGTTAATAGG - Intronic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1036107622 8:5857548-5857570 CCCTCTTTGCTGTAGGAGATTGG - Intergenic
1041793567 8:61722829-61722851 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1042805241 8:72764134-72764156 GCCTCTTTCCTTAAGGTCATTGG - Intronic
1043946557 8:86260576-86260598 CCATCCCTACTGAAGTTAATAGG - Intronic
1044829527 8:96233566-96233588 CCTTCATTTCTGAAGGTAACAGG - Intronic
1046565234 8:115891294-115891316 CCCTAATTACTGAAGAGAATCGG - Intergenic
1051547974 9:18297749-18297771 TCCTCTTAACTGAAGGGAAAGGG + Intergenic
1056210196 9:84358137-84358159 CCTTCCCTACTGAAGCTAATCGG - Intergenic
1059850538 9:118333479-118333501 CCCTCTTTACTTGAGCTACTAGG - Intergenic
1059867124 9:118527989-118528011 CCCTCTTTACATAAGGAAACTGG - Intergenic
1061017500 9:127990468-127990490 TCCTTTATCCTGAAGGTAATGGG + Intergenic
1062333765 9:136056063-136056085 GCCTCTTTTCTGAAGGTATAGGG - Intronic
1187697639 X:21937804-21937826 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1189540079 X:41977975-41977997 CTTTCTTCACTGAAGGAAATAGG - Intergenic
1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG + Exonic
1194464731 X:94219463-94219485 CCATCCCTACTGAAGTTAATAGG - Intergenic
1201542266 Y:15118553-15118575 CCCTATTTAATGAATGTTATTGG + Intergenic