ID: 1035927511

View in Genome Browser
Species Human (GRCh38)
Location 8:3744220-3744242
Sequence CCTGTTGCACACACCTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035927511_1035927515 -7 Left 1035927511 8:3744220-3744242 CCGCAGCAGGTGTGTGCAACAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1035927515 8:3744236-3744258 CAACAGGAGCATGGGAAGTTTGG No data
1035927511_1035927516 0 Left 1035927511 8:3744220-3744242 CCGCAGCAGGTGTGTGCAACAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1035927516 8:3744243-3744265 AGCATGGGAAGTTTGGAATACGG No data
1035927511_1035927517 23 Left 1035927511 8:3744220-3744242 CCGCAGCAGGTGTGTGCAACAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1035927517 8:3744266-3744288 ATCAAAAGATGAGTTTGAAAAGG No data
1035927511_1035927519 30 Left 1035927511 8:3744220-3744242 CCGCAGCAGGTGTGTGCAACAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1035927519 8:3744273-3744295 GATGAGTTTGAAAAGGCGGATGG No data
1035927511_1035927518 26 Left 1035927511 8:3744220-3744242 CCGCAGCAGGTGTGTGCAACAGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1035927518 8:3744269-3744291 AAAAGATGAGTTTGAAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035927511 Original CRISPR CCTGTTGCACACACCTGCTG CGG (reversed) Intronic
900285129 1:1895431-1895453 CCCTCAGCACACACCTGCTGAGG + Intergenic
900332484 1:2142900-2142922 CCTGATGCCCACATGTGCTGAGG + Intronic
901817569 1:11803564-11803586 CCAGTTGAACACACCCGCTGGGG - Intronic
902249955 1:15147806-15147828 CCTGCTGCAGGGACCTGCTGGGG + Intergenic
903543256 1:24108462-24108484 CCTGTGGCTCCCACCTGCTGCGG + Exonic
903549051 1:24144856-24144878 CGTGTTCCACAGACCTGTTGGGG - Intergenic
903573788 1:24325243-24325265 CCTGTGCCACACACCTTCTTTGG + Intronic
903911634 1:26731175-26731197 CCTGTTGACCATACCCGCTGGGG - Exonic
904437727 1:30509604-30509626 CCTGTGGCACACAGCAGTTGAGG + Intergenic
906667750 1:47633506-47633528 CCTGTCTCACAGAGCTGCTGAGG + Intergenic
907308915 1:53528394-53528416 GCTCTGCCACACACCTGCTGTGG + Intronic
910050979 1:82973658-82973680 CCTGTAACACACACCCACTGGGG + Intergenic
915063684 1:153207333-153207355 CCTGTTGCCCACAGCTGAAGGGG - Intergenic
915556054 1:156661412-156661434 CCTGTCCCTGACACCTGCTGGGG + Intergenic
916766274 1:167863648-167863670 CCTGTGGAACATCCCTGCTGGGG + Intronic
917793052 1:178512142-178512164 CCCATTTCACACACCTGCTTGGG - Intergenic
921092165 1:211854769-211854791 CCTGTAACACACACCCACTGGGG - Intergenic
921824819 1:219660788-219660810 CCTGTTGCACACAGGAGGTGGGG + Intergenic
921893835 1:220379128-220379150 CCTGTAACACACACCCACTGGGG - Intergenic
922643344 1:227259097-227259119 CTTGTGGCACACACTTTCTGAGG + Intronic
923395156 1:233554684-233554706 GCTGATGCACACAGGTGCTGAGG + Intergenic
923397827 1:233584438-233584460 ACTGTAACACACACCTTCTGGGG + Intergenic
924501533 1:244643039-244643061 CCTGTAACACACACCCACTGGGG + Intergenic
1063238980 10:4149067-4149089 CCTGTAACACACGCCCGCTGGGG - Intergenic
1064892406 10:20192258-20192280 CCTGATGGACACAACTGCTTAGG - Intronic
1067779208 10:49186847-49186869 CCTATTGCACAGAGTTGCTGTGG + Intronic
1068964569 10:62898792-62898814 GCTGTTGTCCTCACCTGCTGTGG - Intronic
1069784464 10:70978942-70978964 TCTGTGGCACTCACCTGCTGGGG - Intergenic
1070284313 10:75072257-75072279 CCTGTAACACACACCCACTGGGG + Intergenic
1074023704 10:109611967-109611989 CCTGGAGCACACACCTGGGGTGG - Intergenic
1076350401 10:129811342-129811364 CCTGTTCCACACACCTTCGAAGG - Intergenic
1076721056 10:132393467-132393489 CCTTTTGCCCACAGCAGCTGTGG - Intergenic
1077103400 11:832021-832043 CATGTGGCACACACAGGCTGTGG - Intergenic
1077442420 11:2574889-2574911 CCTGCTGCCCAAACCTGCTCAGG - Intronic
1077586636 11:3458976-3458998 CCTGTAACACACACCCACTGGGG - Intergenic
1077708850 11:4515498-4515520 CTTGTTGCTCACCCATGCTGTGG - Intergenic
1078113889 11:8425963-8425985 CCTGTAACACACACCCACTGGGG - Intronic
1078142738 11:8703568-8703590 TATGCTGCACACACATGCTGCGG - Intronic
1078512798 11:11997986-11998008 TCGGATGCACACGCCTGCTGAGG - Intronic
1078577077 11:12511592-12511614 CCTGTTCCTCCCAGCTGCTGCGG - Intronic
1079721233 11:23816958-23816980 CCAGTAGCACACATCTGCTTGGG + Intergenic
1081352126 11:42066605-42066627 CCTGTAACACACACCCACTGGGG + Intergenic
1081917073 11:46739142-46739164 CCTGGTGAACACATCTTCTGGGG + Intronic
1084145381 11:67262424-67262446 AATCTGGCACACACCTGCTGAGG + Intergenic
1084396512 11:68914432-68914454 CCTGCTGCTCAGACCTGCAGGGG + Intronic
1084414684 11:69024732-69024754 CCTGATGCACACAGCCACTGCGG - Intergenic
1084629302 11:70335760-70335782 ACTGTTACACACGCCTGCTCAGG - Intronic
1089095582 11:115917660-115917682 CCTGTTGCAGGCACTGGCTGGGG - Intergenic
1089227821 11:116940762-116940784 CCACTTGCACACTCCTGGTGGGG + Intronic
1090660940 11:128881045-128881067 GTTGGTGGACACACCTGCTGGGG - Intergenic
1091754831 12:3044491-3044513 TCTGTGCCACACACCTGATGTGG - Intergenic
1092757284 12:11775622-11775644 CCTTCTGCACACATCTGGTGGGG - Intronic
1093089421 12:14904716-14904738 CCTGTAACACACACCCACTGGGG + Intronic
1093295214 12:17381489-17381511 CCTGTTCCTCATACCTACTGAGG - Intergenic
1094461100 12:30697065-30697087 CCTGTAACACACACCCACTGGGG + Intergenic
1094635016 12:32217877-32217899 CCTGCTGCTCACGGCTGCTGAGG - Intronic
1096060614 12:48696119-48696141 CCTGCAGTACACACCTCCTGTGG - Exonic
1096171700 12:49476560-49476582 CCTGTAACACACACCCACTGGGG + Intronic
1097622510 12:61957725-61957747 CATGCTGCACTCACCTGCAGAGG - Intronic
1100596846 12:96079165-96079187 CCTCTTGCACACAACTGTTTGGG + Intergenic
1101381931 12:104221136-104221158 CCTGTTAGTCACACCTGCTCAGG + Intronic
1101386576 12:104263436-104263458 TCTGTTGCACACACATGTGGTGG + Intronic
1102645493 12:114400969-114400991 CCTGCTCCACACGCCTGCTCGGG + Intronic
1103019093 12:117519400-117519422 CTTGTTGGACACACCCGCAGAGG + Intronic
1104612935 12:130244245-130244267 GCTCTTGCACTCAACTGCTGAGG - Intergenic
1104668522 12:130664991-130665013 CATGCTGCTCACACCTGCTGAGG - Intronic
1105614628 13:22000699-22000721 CCTGTAACACACACCCACTGGGG + Intergenic
1105638578 13:22239885-22239907 CCTGTAACACACACCCACTGGGG - Intergenic
1107964942 13:45589610-45589632 CCTGTAGCACACAGCTGCCTGGG + Intronic
1108692916 13:52875839-52875861 CCTGTTTCATAAAACTGCTGGGG + Intergenic
1112235130 13:97629140-97629162 CCTGTTGTACTCTCCTGCTCAGG - Intergenic
1112941436 13:104866757-104866779 CCTGTAGCACACACCCACTGGGG + Intergenic
1113741660 13:112715819-112715841 CCTGTTGCTCACACCTCTGGGGG + Intronic
1114902775 14:27085526-27085548 CCAGCTGCACACATCTGCTCTGG - Intergenic
1117252219 14:53949388-53949410 TCTGTTTCACTCACCTGTTGAGG - Intergenic
1120429165 14:84392458-84392480 CCTTTTGTACAGAACTGCTGTGG - Intergenic
1120745313 14:88146644-88146666 CCTGTAACACACACCCACTGGGG + Intergenic
1120907389 14:89632472-89632494 CCTGCTGCACAGACCAGCTCAGG + Intronic
1122359308 14:101150224-101150246 CCTGCAGCCCACACCTGCAGCGG - Intergenic
1122371120 14:101229555-101229577 CCTGTAACACACACCCACTGGGG - Intergenic
1125175069 15:36811619-36811641 CCTGATGCATACACCTGGTTGGG + Intergenic
1125521347 15:40349377-40349399 CCTTCTGCACACATTTGCTGTGG - Intergenic
1128046033 15:64618399-64618421 CCTGTAACACACACCCACTGGGG - Intronic
1128301056 15:66566460-66566482 CCTCTTGCCCTCATCTGCTGTGG + Intergenic
1129464866 15:75718424-75718446 TCTGTTGCACACAGTTGCTGTGG - Intergenic
1129697349 15:77748152-77748174 CCTGGTGTTCACACCCGCTGGGG - Intronic
1130444190 15:83983433-83983455 CCTGTTGGAAACACATGCTTAGG - Intronic
1132731644 16:1365524-1365546 CCTGGTGCACACACAGGCTCAGG + Intronic
1133079333 16:3305890-3305912 CCTGTCGCAGACACAGGCTGTGG + Intronic
1136170119 16:28484090-28484112 CTTGTTGCTCACATCTCCTGAGG - Exonic
1137716670 16:50602320-50602342 CCTGGAGCACAGACCTTCTGGGG - Intronic
1137841067 16:51641329-51641351 CCTGTTGCTCATTCCTGCTGTGG - Intergenic
1140356350 16:74310186-74310208 CCTCTTGCACACTGCTGCTGGGG + Intergenic
1142552114 17:747252-747274 ACGGTTGCAGACACCTCCTGGGG + Exonic
1143292326 17:5840745-5840767 CCTGTAACACACACCCACTGGGG - Intronic
1143659529 17:8315959-8315981 CCTGGTGCCCCAACCTGCTGTGG - Intronic
1144329883 17:14213584-14213606 CCAGTTGCAGTCTCCTGCTGTGG + Intergenic
1148751063 17:49946225-49946247 CCTGCTGCACACACAGGCCGAGG + Intergenic
1149685986 17:58535112-58535134 CTTGTTGGACAGACTTGCTGAGG - Intronic
1150498218 17:65625539-65625561 CCTGTGCCACACACCTTTTGAGG + Intronic
1151092734 17:71461369-71461391 CCTTTTGTTCACACTTGCTGTGG - Intergenic
1152431744 17:80252110-80252132 CCTCTTGTTGACACCTGCTGCGG - Intronic
1152704528 17:81835932-81835954 CCTGCCTCACACACCTGCAGGGG + Intergenic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1153990450 18:10394516-10394538 CCTGTAACACACGCCTACTGGGG - Intergenic
1157002336 18:43542098-43542120 ACTGTAACACACACCTACTGGGG - Intergenic
1157517088 18:48318645-48318667 CCTGCTGCATACACCCCCTGGGG + Intronic
1160270409 18:77378516-77378538 CCTGGTGCTGACACCTACTGTGG + Intergenic
1161468294 19:4444178-4444200 CCGGGTGCCCACACCAGCTGGGG + Intronic
1162131528 19:8529037-8529059 CCTGATCCACCCACCTGCTTTGG - Intronic
1164472349 19:28546780-28546802 CCTGACCCTCACACCTGCTGTGG + Intergenic
1164589854 19:29500753-29500775 CCAGTTGAAAACTCCTGCTGAGG + Intergenic
1165170563 19:33888998-33889020 CCAGCTTCACACAGCTGCTGTGG + Intergenic
1165802582 19:38562054-38562076 CCTCTTGCACACACACCCTGAGG + Intronic
925317197 2:2935615-2935637 CCTGTTGGCCACACCTTCTGCGG - Intergenic
925322904 2:2990544-2990566 CCTATTTCCCACACATGCTGAGG - Intergenic
925894711 2:8462481-8462503 CCAGTGGCAGACACCTGCTCTGG + Intergenic
926310866 2:11675195-11675217 CCTTCTGCACACGCCTGTTGAGG - Intergenic
926491755 2:13532999-13533021 CCTGTGGAACATGCCTGCTGGGG - Intergenic
928359829 2:30654208-30654230 GCTTTTCCACACACCTGCTTGGG + Intergenic
928537886 2:32257894-32257916 CCTGTAACACACACCCACTGGGG - Intronic
928891310 2:36206204-36206226 CCTGTTGCACACTCTTGTTCAGG - Intergenic
931438128 2:62266686-62266708 TCTGCTGCACACAGCTGCTTTGG + Intergenic
932136293 2:69231926-69231948 CCTGTAGTACACATGTGCTGTGG - Intronic
932615178 2:73227034-73227056 CCTGCTGCATTCTCCTGCTGAGG + Exonic
932931462 2:76044782-76044804 CCTGTTACACACGCCCACTGAGG - Intergenic
935740683 2:106144911-106144933 CCTGTAGTACACATCTGCTGTGG - Intronic
936462189 2:112722095-112722117 CCTGAGCCACACACCTGGTGGGG - Exonic
937230435 2:120395388-120395410 CCTGTTCCACAGTCCTGCTCCGG + Intergenic
937383489 2:121403823-121403845 GCTGGTGCCCACACCTCCTGAGG - Intronic
937771726 2:125727609-125727631 CCTGTAACACACACCCACTGGGG + Intergenic
940070897 2:149686747-149686769 CTTGGTGCACACAGCTGCTTTGG + Intergenic
940419963 2:153469488-153469510 CCTGTTCCACACTTCTGATGAGG - Intergenic
940596296 2:155796807-155796829 CCTGTTGCACACGGCTGAGGAGG + Intergenic
940599925 2:155845710-155845732 CCTGTAACACACACCCACTGGGG + Intergenic
941309644 2:163912821-163912843 ACTGTAACACAAACCTGCTGGGG + Intergenic
941645920 2:168041108-168041130 CCTCCTGGACACACCTGCTGAGG - Intronic
944063682 2:195596463-195596485 CCCGTTGCCCACAAGTGCTGTGG + Intronic
944306906 2:198189099-198189121 ACTGTAACACACGCCTGCTGGGG + Intronic
945802510 2:214450748-214450770 TCTGTTGATGACACCTGCTGAGG + Intronic
948178621 2:235962712-235962734 CCTCTCGCACACACCTCCTTTGG - Intronic
948707201 2:239802319-239802341 GCTGCTGCAGAAACCTGCTGGGG + Exonic
948901526 2:240958916-240958938 CCTGTCGCACACACCACCCGAGG - Intronic
948952508 2:241263337-241263359 CCTGGTGCACACACCAGAGGGGG + Intronic
1169709315 20:8543636-8543658 CCTGTTGGACACATCTGATACGG + Intronic
1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG + Intronic
1170763018 20:19268191-19268213 CCTGTTGCCCACAGCAGGTGAGG - Intronic
1171349207 20:24490110-24490132 CCTGTTCCATCCACATGCTGTGG + Intronic
1172626413 20:36350026-36350048 GCTGGTGCACTCACCTGCTTGGG - Intronic
1174796227 20:53524862-53524884 CCGGTTTAACACACCTGCAGTGG + Intergenic
1174932320 20:54829357-54829379 CCTATTGCTCACAACTGCTCTGG - Intergenic
1175207998 20:57326780-57326802 GGTGGTGCACACAGCTGCTGGGG + Intergenic
1175959779 20:62630134-62630156 CCTGGATCCCACACCTGCTGAGG + Intergenic
1176995730 21:15553074-15553096 CCTGTTGCACCAACATGCTTTGG - Intergenic
1179904589 21:44415837-44415859 CCTGGGGCCCACAGCTGCTGCGG - Intronic
1181100107 22:20533216-20533238 CCCATTTCACACTCCTGCTGAGG - Intronic
1182412475 22:30198920-30198942 GCTGGTACACAGACCTGCTGAGG - Intergenic
1184125414 22:42483256-42483278 CTTTTCTCACACACCTGCTGTGG - Intergenic
1184133898 22:42534754-42534776 CTTTTCTCACACACCTGCTGTGG - Intergenic
1184411032 22:44326630-44326652 CCGTTTGCACACATCTGTTGGGG + Intergenic
949444167 3:4115473-4115495 CCTGTAACACACACCCACTGGGG + Intronic
949861789 3:8512100-8512122 CAGGGTGCACACACATGCTGTGG - Intronic
950418960 3:12885548-12885570 CCAGCTGCAGACCCCTGCTGGGG - Intergenic
952109803 3:30109328-30109350 GCTGTAACACACACCTTCTGAGG + Intergenic
952336781 3:32410485-32410507 GCTGTGTCAGACACCTGCTGAGG + Intronic
953088421 3:39697680-39697702 CCTGTAACACACACCCCCTGGGG + Intergenic
953131403 3:40142886-40142908 CCTCTCGTACACACCTACTGAGG + Intronic
953636647 3:44670322-44670344 CTGGTTGCACAGGCCTGCTGTGG + Intergenic
953821399 3:46210328-46210350 CCCATTGTACACATCTGCTGTGG - Intronic
954627827 3:52032277-52032299 CCTGTTGCAGATACGGGCTGGGG - Intergenic
954736547 3:52712438-52712460 CCTGTAACACACACCCACTGGGG - Intronic
954851487 3:53604629-53604651 CCTGCTTTACAGACCTGCTGTGG + Intronic
956511720 3:70000142-70000164 CCAGTAACACACGCCTGCTGGGG + Intergenic
960415825 3:117383599-117383621 CCTGTAACACACACCCACTGGGG + Intergenic
961709048 3:128812883-128812905 CCTCGTGCACACACTGGCTGAGG + Intronic
963008458 3:140748319-140748341 CCACTTGCCCACTCCTGCTGAGG - Intergenic
963821777 3:149904503-149904525 CCTGTAGCCCCCAGCTGCTGGGG - Intronic
965321055 3:167251380-167251402 CCTGTAACACACACCCACTGGGG + Intronic
965534974 3:169813985-169814007 CCTGTAACACACGCCTACTGGGG - Intergenic
968554340 4:1239640-1239662 CCTGCAGCACACGCCTGCAGGGG + Intronic
969416180 4:7060963-7060985 CTTGTTCCACACACCGGTTGAGG - Exonic
969472251 4:7395839-7395861 CCTGCTGGAAACAGCTGCTGGGG - Intronic
969555530 4:7906304-7906326 CCTTTTTCACAGAACTGCTGAGG + Intronic
972918469 4:43907369-43907391 CCTGTAACACACACCCACTGAGG + Intergenic
974810132 4:66935384-66935406 CCTGGTGCACACTACTGCAGAGG + Intergenic
975376703 4:73654475-73654497 CCTTTCTCACACACTTGCTGAGG + Intergenic
980286411 4:130783357-130783379 CCTTTAGCACACACCAACTGGGG + Intergenic
981029656 4:140111677-140111699 CCTGTTACTCACCCCTACTGTGG + Intronic
983316826 4:166143139-166143161 CCTAATGCACACACCTTGTGTGG + Intergenic
984081715 4:175255371-175255393 CCTGTAACACACACCCACTGGGG + Intergenic
985971914 5:3384876-3384898 CCTGTTGCCCACGGCTGCTGGGG + Intergenic
986257371 5:6111349-6111371 CCTCTTCCAGACACCTGCTCAGG - Intergenic
987336161 5:16899590-16899612 CTTGTTGCCCAGGCCTGCTGTGG - Intronic
994168079 5:96628911-96628933 TCTGATGCACATACTTGCTGTGG + Intronic
994301883 5:98157263-98157285 CCTGTAACACACACCCACTGGGG - Intergenic
995728147 5:115203798-115203820 TCTGTTGCACACTGCTGCTCTGG - Intergenic
999633485 5:153596446-153596468 CCTCTTTCACAGGCCTGCTGTGG - Intronic
1000358890 5:160429531-160429553 CCTGTTTCCAACACTTGCTGGGG + Intergenic
1001181181 5:169522098-169522120 CCTGTAACACACGCCTACTGAGG + Intergenic
1001305476 5:170569296-170569318 CCTGTTGCACACAGCAGCGGGGG - Intronic
1001591534 5:172868940-172868962 CCTGCTGCACATCACTGCTGGGG - Intronic
1002774602 6:318085-318107 CCTGTTCTACAGAGCTGCTGTGG + Intronic
1002942340 6:1729020-1729042 CCAGTTGCCCACTCCTGCTTCGG + Intronic
1004953585 6:20702292-20702314 CCTGTAACACACGCCTACTGGGG - Intronic
1005461219 6:26071766-26071788 CCTGTAACACACACCCACTGTGG + Intergenic
1005759328 6:28953352-28953374 AGTGTTGAAAACACCTGCTGAGG - Intergenic
1005867793 6:29949235-29949257 CCTGGGGGACACACCTGTTGGGG + Intergenic
1007127830 6:39442195-39442217 TCTGATTCACCCACCTGCTGCGG + Intronic
1010533349 6:76992854-76992876 CCTGTTGCACACCCTTCCAGGGG + Intergenic
1011801634 6:91022379-91022401 CCTGTAACACACACCCACTGGGG + Intergenic
1013561396 6:111309097-111309119 CCTGTAACACACACCCACTGGGG - Intronic
1014487449 6:122016781-122016803 CCTGTCCCACCCACCTGTTGAGG - Intergenic
1015750312 6:136552154-136552176 CCTGTTGCAGACACCTCCTTAGG - Intergenic
1017545311 6:155444788-155444810 CCTGTTTCAGGCATCTGCTGTGG + Intronic
1018318359 6:162580595-162580617 CCTGTTCCTGACACTTGCTGGGG - Intronic
1018363765 6:163098261-163098283 CCTGTTCCACACACAGGCAGGGG - Intronic
1018465200 6:164037907-164037929 CCTGTGGCACCCACCTGCCCTGG - Intergenic
1018906633 6:168079594-168079616 CCTGCCCCACACACCTCCTGTGG + Intronic
1023405247 7:39826799-39826821 CCTGCAGCAGACACCAGCTGGGG - Intergenic
1023855337 7:44179743-44179765 CCTGTTATACACACTTGCTGTGG - Intronic
1024051165 7:45624301-45624323 CCTGTTGCAGACACCTGGTTAGG + Intronic
1024064758 7:45723177-45723199 CCTGTTTCACATAACTTCTGGGG + Intergenic
1024643833 7:51355205-51355227 CCTGTAACACACACCCACTGGGG - Intergenic
1027932309 7:84552992-84553014 CCTGTTACACACACCCACTGGGG + Intergenic
1028470986 7:91206189-91206211 GCTGCTGCACACACAGGCTGTGG - Intronic
1030513576 7:110515260-110515282 ACTGTAACACACACCCGCTGGGG - Intergenic
1032916413 7:136495096-136495118 CATCTTACACACACCTTCTGAGG - Intergenic
1035273741 7:157735080-157735102 CCTGTCTCCCAGACCTGCTGGGG + Intronic
1035477857 7:159156317-159156339 CCTGGTGCTCCCGCCTGCTGTGG + Intergenic
1035927511 8:3744220-3744242 CCTGTTGCACACACCTGCTGCGG - Intronic
1036416202 8:8551061-8551083 TCTGTTGCACAGAACTGCAGGGG + Intergenic
1036472799 8:9065846-9065868 CCTGTTGCAAACTCATGTTGTGG + Intronic
1037667778 8:20985238-20985260 ACTGTTGCACATACCTGCAAGGG - Intergenic
1037948911 8:23006310-23006332 CCTGTTGCACACCTCTGGTGTGG + Intronic
1038062516 8:23928738-23928760 CCTGCTGCTACCACCTGCTGAGG + Intergenic
1038248627 8:25882138-25882160 CCTGTAACACACACCCACTGGGG + Intronic
1040328656 8:46374961-46374983 CCTGGAGCACACCCCTGGTGGGG - Intergenic
1040787426 8:51181841-51181863 CCTGTAACACACACCCACTGGGG + Intergenic
1041713233 8:60911622-60911644 ACTGTTGCAAATGCCTGCTGCGG + Intergenic
1041934752 8:63322650-63322672 CCTGTAACACACGCCTACTGGGG + Intergenic
1041988369 8:63954437-63954459 ACTGTAACACACACCTTCTGGGG - Intergenic
1042440293 8:68818230-68818252 TCTGTTTCACAAACCTGCAGAGG - Exonic
1044519332 8:93179508-93179530 CCTCTTCCACTCACCTACTGTGG - Intergenic
1044531935 8:93317022-93317044 CCTGTTGAAAACACCTTCAGAGG - Intergenic
1046260914 8:111766232-111766254 ACTGTTACACACGCCTGTTGGGG + Intergenic
1047202071 8:122775762-122775784 CCTGTAACACACACCCACTGGGG - Intergenic
1049158407 8:141081731-141081753 TCTGTAGCAAACACCAGCTGGGG + Intergenic
1049978828 9:885195-885217 CCTGTAACACACACCCACTGGGG - Intronic
1050829142 9:9989745-9989767 ACTGTGACACACACCCGCTGGGG + Intronic
1051079469 9:13278889-13278911 CCTGTTGCTCTCCCCTGCAGGGG - Intronic
1052215839 9:25964712-25964734 CCTGTTGCTGACACCCACTGGGG + Intergenic
1052690373 9:31809077-31809099 CCTGTAACACACACCCACTGGGG - Intergenic
1057263501 9:93599161-93599183 CCTATTGCATGCACCTGCAGGGG + Intronic
1059066272 9:111088548-111088570 CTTGTAGCACAGATCTGCTGGGG - Intergenic
1061876241 9:133545528-133545550 TCTGCAGCACAGACCTGCTGGGG - Intronic
1061888389 9:133604940-133604962 CCTGTTGCACACAGAAACTGTGG + Intergenic
1061907258 9:133705031-133705053 CCTGTTCCCCACTCCTGCTCAGG - Exonic
1061925590 9:133804680-133804702 ACTGTACCCCACACCTGCTGAGG + Intronic
1062583510 9:137238433-137238455 CCTGTTGCACAAAACTGGTTGGG - Intergenic
1062656412 9:137606228-137606250 CGGGGTGCAGACACCTGCTGCGG + Intronic
1187365273 X:18661413-18661435 TCTGTAACACACGCCTGCTGGGG - Intronic
1189350588 X:40272851-40272873 CCTGTTTCCCGCACCTGGTGGGG + Intergenic
1191958215 X:66669550-66669572 ACTGTTGCACATATCTGCAGAGG + Intergenic
1195687821 X:107601879-107601901 CCTGCTGCACAGGGCTGCTGCGG - Exonic
1195832797 X:109077994-109078016 CCTGTTGCACTTCCCTGGTGAGG + Intergenic
1197777561 X:130129168-130129190 CTCTTTGCACACACCTGCTGTGG - Intergenic