ID: 1035932764

View in Genome Browser
Species Human (GRCh38)
Location 8:3801905-3801927
Sequence CAATGCCTAGGGTATAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035932756_1035932764 6 Left 1035932756 8:3801876-3801898 CCACATATTATGAGATCTCATAT 0: 1
1: 0
2: 0
3: 26
4: 295
Right 1035932764 8:3801905-3801927 CAATGCCTAGGGTATAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035932764 Original CRISPR CAATGCCTAGGGTATAGGGT GGG Intronic
No off target data available for this crispr