ID: 1035933184

View in Genome Browser
Species Human (GRCh38)
Location 8:3807082-3807104
Sequence TAACCTTCCCCCAGTGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035933184_1035933188 -6 Left 1035933184 8:3807082-3807104 CCCCACGCACTGGGGGAAGGTTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1035933188 8:3807099-3807121 AGGTTAAATTGACTTTAATAGGG No data
1035933184_1035933187 -7 Left 1035933184 8:3807082-3807104 CCCCACGCACTGGGGGAAGGTTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035933184 Original CRISPR TAACCTTCCCCCAGTGCGTG GGG (reversed) Intronic
900324989 1:2104336-2104358 TAACCTTCCCTCAGCCCGTGGGG - Intronic
900335936 1:2163462-2163484 GAACCTTCTCCCAGTGGCTGGGG - Intronic
901207739 1:7506340-7506362 CAACCTTCCCCCTGGGAGTGGGG - Intronic
901274577 1:7981178-7981200 GAAACTTCCCACAGTGAGTGGGG - Intronic
902343190 1:15797997-15798019 TGACCTTCACCCAGTGTGAGTGG + Intergenic
904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG + Intergenic
913496531 1:119433043-119433065 TCACCTTACCCCACTGCCTGGGG - Intergenic
913512418 1:119573833-119573855 TCACCTTACCCCACTGCCTGGGG - Intergenic
1071934908 10:90518357-90518379 TAACCTTCTCCCAATGAGTTTGG - Intergenic
1072632424 10:97155457-97155479 TAACCTTCCACCAGCCCTTGGGG - Intronic
1073792784 10:106956713-106956735 CAACCTTTCCCCAGTCAGTGTGG - Intronic
1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG + Intronic
1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG + Intronic
1088421195 11:109649144-109649166 TAACCATCCCCCAATGCCTGTGG + Intergenic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG + Intronic
1102195401 12:111021783-111021805 TGACCTTCCCACTGTGGGTGAGG - Intergenic
1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG + Intronic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1113725066 13:112592468-112592490 TAACCTTCACCCAGTGCCGTGGG - Intergenic
1121335158 14:93073426-93073448 TAACCTTCCCGAGGTGGGTGTGG - Intronic
1123806523 15:23879635-23879657 TAATCCCCTCCCAGTGCGTGTGG - Intergenic
1125771596 15:42171081-42171103 TAACCAGCCCCCAGTCAGTGAGG - Intronic
1130094458 15:80845701-80845723 TAACCTTCCCACAGTGACTTTGG + Intronic
1130379877 15:83362422-83362444 TAATATTCCCCCAATGCATGAGG - Intergenic
1131069002 15:89452618-89452640 GAACCCTCCCCCAGAGGGTGGGG - Intergenic
1134541860 16:15073580-15073602 TGACCTTGCCACAGTGTGTGAGG - Intronic
1139461717 16:67127899-67127921 TTACCTTCCCCCAGTGTTTCTGG - Intronic
1144585994 17:16488131-16488153 TAACCTTCCGCCATTGAGAGAGG - Intronic
1148211140 17:45809385-45809407 TAACCTGGCCCCAGAGCATGGGG - Intronic
1149055362 17:52356842-52356864 TGCCCTGCCCCCAGGGCGTGGGG + Intergenic
1156911110 18:42412031-42412053 TACCCTTCCCCCAATGGATGTGG - Intergenic
1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG + Intergenic
1158038857 18:53068883-53068905 AAACCTGCCCCCAGTGTCTGAGG + Intronic
1159518360 18:69487426-69487448 AAATCTGCCCCCAGTGTGTGAGG + Intronic
1159929986 18:74300837-74300859 TAGCCTTCTCCCAGTTTGTGAGG + Intergenic
1162344091 19:10109821-10109843 CACCCTTCCCACAGTGCGTCAGG - Intronic
1162423499 19:10579803-10579825 TAAAATTCCACCAGTGCGTGCGG - Exonic
1162935131 19:13978377-13978399 TAGCCTTGCCCCTGTGCCTGGGG - Intronic
928581473 2:32712050-32712072 TAACCTTGCCCCAGTTTGTCTGG + Intronic
931798651 2:65736804-65736826 AAATCTTCCCCCAGTGTGAGTGG + Intergenic
934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG + Intergenic
937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG + Intergenic
942619687 2:177833945-177833967 CACCATTCCCCCAGTGCATGTGG - Intronic
948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG + Intronic
1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG + Intronic
1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG + Intergenic
1178460124 21:32795474-32795496 TAACATTCCCCCAATGACTGAGG + Intronic
1178980680 21:37261773-37261795 TGACATTCCCACAGTGCATGAGG + Intronic
1180233750 21:46443930-46443952 TGACCTTCCCCCACTGTGTGGGG - Exonic
1181393465 22:22600743-22600765 TACCCTTCCTTCAGTGCATGGGG + Intergenic
952189625 3:31008965-31008987 TCACATTCCCACAGTGAGTGAGG - Intergenic
961614486 3:128168126-128168148 TAAACTTGCCCCAGAGCTTGGGG + Intronic
963654096 3:148023856-148023878 AAATCTTTCCCCAGTGAGTGTGG + Intergenic
970166092 4:13240077-13240099 TGACCTTTCCTCAGTGCTTGAGG - Intergenic
976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG + Exonic
977418620 4:96766614-96766636 TAATCTTGGCCCAGTGCCTGAGG - Intergenic
989754888 5:44940388-44940410 TAAACTTGCCTCAGTGTGTGGGG - Intergenic
1025738216 7:64173800-64173822 AACCCTTCTCCCAGGGCGTGGGG - Intronic
1028380565 7:90194622-90194644 GAACCGTCCCCCAGTGATTGAGG + Intronic
1030456378 7:109779858-109779880 TAACCTCCACCCAGTACATGGGG + Intergenic
1031757216 7:125660199-125660221 TGACCTTTCCACAGTGCATGGGG - Intergenic
1034948735 7:155282270-155282292 CAACAATGCCCCAGTGCGTGGGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041472540 8:58226336-58226358 TAATCTTGCCCCAGTGAGAGGGG + Intergenic
1048510477 8:135057359-135057381 CATCCTTCCCACGGTGCGTGAGG - Intergenic
1049998028 9:1049736-1049758 TAACCTTCACCGAGCCCGTGTGG - Intergenic
1054748837 9:68883886-68883908 TATCCTTTCCCCATTGTGTGTGG - Intronic
1055002012 9:71461942-71461964 TAACCTTTCCCCAAAGAGTGAGG - Intergenic
1056913765 9:90727715-90727737 TCACCTTCTCCCAGTGCGGCAGG - Intergenic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG + Intronic
1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG + Intergenic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1198055131 X:132986378-132986400 GAATTTTCCCCCAGTGTGTGAGG + Intergenic