ID: 1035933187

View in Genome Browser
Species Human (GRCh38)
Location 8:3807098-3807120
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035933183_1035933187 -6 Left 1035933183 8:3807081-3807103 CCCCCACGCACTGGGGGAAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data
1035933184_1035933187 -7 Left 1035933184 8:3807082-3807104 CCCCACGCACTGGGGGAAGGTTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data
1035933186_1035933187 -9 Left 1035933186 8:3807084-3807106 CCACGCACTGGGGGAAGGTTAAA 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data
1035933185_1035933187 -8 Left 1035933185 8:3807083-3807105 CCCACGCACTGGGGGAAGGTTAA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data
1035933177_1035933187 3 Left 1035933177 8:3807072-3807094 CCATGGCTTCCCCCACGCACTGG 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1035933187 8:3807098-3807120 AAGGTTAAATTGACTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr