ID: 1035938669

View in Genome Browser
Species Human (GRCh38)
Location 8:3871655-3871677
Sequence CCTCTGTATGAAAAGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035938669_1035938671 -4 Left 1035938669 8:3871655-3871677 CCTTTAATCTTTTCATACAGAGG 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1035938671 8:3871674-3871696 GAGGTCAATCATTTTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035938669 Original CRISPR CCTCTGTATGAAAAGATTAA AGG (reversed) Intronic
903102833 1:21047922-21047944 CCTCTGTCTGAAAGGATGGAGGG + Intronic
906933184 1:50189293-50189315 CCTGTGTATGAACAGGTAAAGGG + Intronic
909785682 1:79609432-79609454 CCTCTAAATTAAAAGATTTATGG + Intergenic
909979017 1:82076279-82076301 TTTCTGCATGAAAAGATTTAAGG + Intergenic
910193919 1:84621400-84621422 TCTCTGAATGATGAGATTAAAGG - Intergenic
911898015 1:103464168-103464190 TATCTGTAGGAAAATATTAAAGG + Intergenic
913211931 1:116589406-116589428 TCTCTGCTTGAAAAGTTTAATGG + Intronic
913224292 1:116685289-116685311 CCACTGTATGAAAATGTTGAAGG - Intergenic
914452996 1:147809962-147809984 TCACTGAATGAAAAGATAAATGG - Intergenic
916585316 1:166144869-166144891 CCTTTTTATGGAAAGATTGATGG - Intronic
918679746 1:187338543-187338565 CCTTTGTTTTAAATGATTAATGG + Intergenic
919095002 1:193022882-193022904 GCTCTATATTAAAACATTAAAGG + Intronic
919323422 1:196073354-196073376 CTTATGTATTAACAGATTAAGGG - Intergenic
919974437 1:202601683-202601705 CATCTGTAAAAAAAGACTAAAGG + Intronic
921827577 1:219690954-219690976 CCTCTTTATGTAATGATGAAAGG + Intronic
922150485 1:222998927-222998949 CCTATGTATTAAACGTTTAAGGG - Intronic
1063299064 10:4835512-4835534 CCTTTCTAAGAAAAGATGAATGG - Intronic
1063919416 10:10917274-10917296 CCTCTGTTTCAAAAGCTTACTGG - Intergenic
1064611889 10:17112317-17112339 CCTCTGTGTGATAAGATCAAAGG + Intronic
1065545954 10:26820886-26820908 CCTATGTTAGAAAAGATTAAGGG + Intronic
1069401758 10:68055477-68055499 CCTCTGTATAAATATATAAAAGG - Intronic
1071083726 10:81843167-81843189 CATTTGTATGGAAAGAATAAAGG - Intergenic
1071427645 10:85575423-85575445 CCTGTGCAGAAAAAGATTAAGGG - Intergenic
1073261939 10:102197060-102197082 CAGCTGTATGAAAAGCTGAACGG - Intergenic
1073969001 10:109025315-109025337 CCACTGCATGATAAGATTAAAGG - Intergenic
1074237088 10:111596162-111596184 GCTCTATATGAAAAGATTCTAGG - Intergenic
1075121989 10:119671039-119671061 CCTCTCTAAGAAAAGAAAAAAGG - Intronic
1075970616 10:126649311-126649333 CTTCTGCATGAAAGGATTACAGG - Intronic
1078422043 11:11220489-11220511 CCTCTGTCTGAAGAGAAAAACGG + Intergenic
1080064730 11:27998439-27998461 CCTCTTTCTGAAAATTTTAATGG - Intergenic
1085872963 11:80371975-80371997 CCTGTGTAAGAAAAGATGCAGGG + Intergenic
1086459676 11:86994316-86994338 CCTGAGTATGAAAAGATCAGAGG - Intergenic
1086799989 11:91161049-91161071 CCTCTTTAAGAATAAATTAATGG + Intergenic
1090529063 11:127571060-127571082 CCTGTGTATGAAATTTTTAATGG - Intergenic
1091935819 12:4433723-4433745 CCTCTGAATGGAAAGATGATTGG + Intronic
1093727553 12:22532544-22532566 CCTCTATTGGAAAAGCTTAAAGG - Intronic
1094436956 12:30431248-30431270 CTACTATATGAAAAGAGTAAAGG - Intergenic
1095478070 12:42606189-42606211 GCTCTTTATGAAAAAATCAAAGG - Intergenic
1095556876 12:43517687-43517709 ACTCTGTATGTAAAATTTAAAGG + Intronic
1096031790 12:48423775-48423797 TCTCTTTATTAATAGATTAATGG - Intergenic
1097652133 12:62312319-62312341 TCTGTGTATGAAAAGTTTCATGG - Intronic
1100737213 12:97549608-97549630 GCTCTGCATGAACAGAGTAATGG - Intergenic
1101414777 12:104499520-104499542 CCTCAGCAAGAAAACATTAAAGG + Intronic
1105215181 13:18280032-18280054 TCTCTGCTTGAAAAGTTTAATGG + Intergenic
1105750154 13:23415920-23415942 CTTCTGGATGAAATCATTAAAGG - Intronic
1106607775 13:31247157-31247179 CCTCTTAATAAAAAGACTAAGGG - Intronic
1106684325 13:32042153-32042175 CCACTTTATGAAAAGAAGAAAGG + Intronic
1107148218 13:37082760-37082782 TCTATGTATGAGACGATTAAAGG - Intergenic
1111732258 13:92090649-92090671 TCTCTGTATTACAATATTAACGG - Intronic
1114352405 14:21867518-21867540 CTTCTGTAAGAATAAATTAATGG - Intergenic
1115018544 14:28646568-28646590 CCTCTGTAAGTAAATATTAAAGG + Intergenic
1116268770 14:42732228-42732250 TCTATATATGCAAAGATTAATGG - Intergenic
1118262773 14:64262901-64262923 ACTCTGTCTCAAAAGATAAAAGG + Intronic
1119638351 14:76294610-76294632 ACTCTGTCTCAAAAAATTAAAGG - Intergenic
1121749935 14:96343556-96343578 CCTCTTCATGAAAATATTTATGG - Intronic
1125307163 15:38331759-38331781 CCTCTGTCTTAAACAATTAAGGG + Intronic
1126054035 15:44712617-44712639 CCTCTGTACGAAAAGACCACAGG - Intronic
1129647931 15:77455025-77455047 CATCTCTATGAAAAGACTTAGGG + Intronic
1130398559 15:83527954-83527976 GCTCTGTAAGAAATGCTTAACGG - Intronic
1133404621 16:5513364-5513386 CCTCGATATGACATGATTAAAGG - Intergenic
1133455835 16:5941711-5941733 CCTCTGTATGGAAAAAAAAATGG - Intergenic
1138942789 16:61810056-61810078 CCTCTGTATGGAAAATTTATAGG + Intronic
1139211977 16:65087059-65087081 GCTCTGTATCAAAAGATTCTAGG - Intronic
1143714812 17:8759314-8759336 CCTGTGTATAAAAAGACTAAGGG + Intergenic
1144010671 17:11145855-11145877 CCTCTGTGTGAACAGGTAAATGG - Intergenic
1144564817 17:16351553-16351575 CCTCTGGGTGTAAAGATTACAGG - Intronic
1146924235 17:36733015-36733037 CATCTGTAGGGAAATATTAAGGG + Intergenic
1148076603 17:44940389-44940411 CCTCTACATTAATAGATTAAAGG - Intronic
1149354680 17:55827738-55827760 CCTCTCTGGGAAAAGATTACAGG + Intronic
1153943298 18:9995472-9995494 CCTCTCTTTTAAAAGATGAAAGG - Intergenic
1154392476 18:13951759-13951781 CCTGTATTTAAAAAGATTAAAGG - Intergenic
1155331347 18:24721704-24721726 CCTCTGTCTGTATAGTTTAATGG + Intergenic
1155633489 18:27922939-27922961 TCTCTGAATGAAAAAAATAATGG + Intergenic
1156591300 18:38491710-38491732 ACTATGTATTAAAAGATAAAAGG - Intergenic
1158851794 18:61502124-61502146 ACACTGTAGGCAAAGATTAAAGG - Intronic
1159173740 18:64807504-64807526 CAATTGTATGAAAAGACTAAAGG + Intergenic
1166810593 19:45512137-45512159 ACTCTGTCTCAAAAGATAAATGG + Intronic
925855725 2:8127325-8127347 CCTTTGTATTAAAATTTTAACGG + Intergenic
926938577 2:18112243-18112265 CCTGTGGATGGAAAGAGTAAAGG + Intronic
931495876 2:62806531-62806553 CCTCTCTATGAAAAAATTAGTGG - Intronic
932134732 2:69218379-69218401 CCTCAGTATAAAAATATAAAGGG - Intronic
934299139 2:91766705-91766727 TCTCTGCTTGAAAAGTTTAATGG - Intergenic
935152057 2:100446614-100446636 CATCTTTATGAAAAGATTCTGGG - Intergenic
936923176 2:117709753-117709775 CCTCTCTAATAAAAGATTACAGG + Intergenic
937367665 2:121275897-121275919 CCTCTGTAAGAATAAATTATTGG + Intronic
937500962 2:122478486-122478508 TCTCTCTATGAAAATCTTAATGG + Intergenic
939733987 2:145820626-145820648 CTGCTGTATGAATAGATTGAAGG - Intergenic
943154444 2:184155505-184155527 ACTGTGTATGAAAAAAATAATGG - Intergenic
943809805 2:192170723-192170745 TCTCTCTCTGAAAAGAATAAAGG - Intronic
944535468 2:200705382-200705404 CCTCTGTATGAAAGAATCACTGG + Intergenic
945584720 2:211645574-211645596 TCTCTGTATAACATGATTAATGG + Intronic
948677307 2:239604398-239604420 CCTATGTATGCCAACATTAATGG + Intergenic
1169313521 20:4568682-4568704 CCTCTGTAGGACAACATCAAAGG + Intergenic
1171070782 20:22066385-22066407 CCTCCAGATGAAAAGCTTAATGG - Intergenic
1172716229 20:36965867-36965889 ACTCTGTCTGAAAAAATAAAAGG + Intergenic
1172718257 20:36979995-36980017 ACTCTGTCTGAAAAAATAAAAGG - Intergenic
1172821209 20:37736340-37736362 CTGCTGTAGGAAAAGATTAAGGG + Intronic
1174388566 20:50202189-50202211 ACTATGTATCAAAACATTAAGGG - Intergenic
1175079606 20:56408186-56408208 CCTCTGTATCAAAATAAAAATGG + Intergenic
1175129122 20:56775955-56775977 CCTCTGAAGGAAAGGATCAAAGG + Intergenic
1177550970 21:22621936-22621958 CCTCTGCAGGAAAATATCAATGG + Intergenic
1177870517 21:26567242-26567264 CATCTGGATGAAAAGATGATTGG + Intronic
1177931623 21:27292320-27292342 ACTCTGTATAAAAAGATTCCAGG - Intergenic
1180556085 22:16576417-16576439 TTACTGTATGAAAAGATTATGGG + Intergenic
949886976 3:8703230-8703252 CTTCTGTAAGAAACGAATAAAGG + Intronic
950347462 3:12310382-12310404 AATCTGTATGTAAAAATTAAAGG - Intronic
952366111 3:32676419-32676441 ACTCTGTATGAAACCATCAAAGG + Intergenic
953611696 3:44452262-44452284 TCTCTGTATCAGATGATTAATGG - Intronic
954686707 3:52374737-52374759 CATCTCTATGAACAGATTCAGGG - Intronic
957497132 3:81007043-81007065 CCTCTGTGAGAAAACACTAATGG + Intergenic
958683313 3:97358716-97358738 CCTCTGCAAGAAATGCTTAAAGG - Intronic
959332151 3:105020107-105020129 CCTGAGTATCACAAGATTAAGGG - Intergenic
959563789 3:107813849-107813871 CCTATGTATTAAAAGGTTTAAGG - Intergenic
960595560 3:119404786-119404808 ACTCTGAATGAAAAAATTGAAGG + Intronic
964216629 3:154291727-154291749 AGTCTGTATCGAAAGATTAATGG + Intronic
965757814 3:172042199-172042221 AGTCTGTATTAAAAGATTACCGG - Intronic
968341512 3:197959837-197959859 CCTCTGTATGAAAAGGTGAGTGG - Exonic
972013447 4:34214167-34214189 CCTCAGTATGAACACATGAAGGG + Intergenic
975901850 4:79162824-79162846 CCTCTTTAGGAAAAGCTTAATGG - Intergenic
976637400 4:87300700-87300722 CAACTGTATGCAAAGCTTAAAGG - Intergenic
977175911 4:93819169-93819191 GCTCTGTATGAAGAGAGAAATGG + Intergenic
978133445 4:105228320-105228342 CATTTGTGTGAAAAGTTTAATGG - Intronic
979557273 4:122063107-122063129 ACCCTGTCAGAAAAGATTAAAGG + Intergenic
982048420 4:151473613-151473635 TCTCTGTGTGAAAAGCTTAAAGG + Intronic
982263212 4:153514181-153514203 CCTCTGTAAAACAAGACTAATGG + Intronic
984520444 4:180795807-180795829 CCCATGTATGAAGAGATTCAAGG + Intergenic
985312084 4:188613313-188613335 CCTCTGTATAAGAAGAGTAATGG - Intergenic
987536992 5:19202293-19202315 CCTCTGGATGAGAAAATAAAGGG - Intergenic
988327026 5:29782735-29782757 CTTCTGTATGTAAAGATTGATGG - Intergenic
988381836 5:30507182-30507204 CCTGGCTATGAAAATATTAATGG + Intergenic
988946810 5:36211575-36211597 CATCTATATAAACAGATTAAAGG + Intronic
990296958 5:54411567-54411589 CTTCTGTCTGAAAAAAATAATGG - Intergenic
991339663 5:65594753-65594775 CCTCTGTGTGAAAATAATGATGG - Intronic
994086452 5:95764696-95764718 CATCTATATTAAAAAATTAAAGG - Intronic
994786050 5:104164745-104164767 CATCTGTCAGAAAAGTTTAACGG - Intergenic
994943914 5:106361013-106361035 CCTTTTTATTAAAAGATTACTGG + Intergenic
996696382 5:126401031-126401053 CCTCTGAAAGAAAAGAGAAATGG - Intronic
998054252 5:139060997-139061019 CATCTGTAAGAAAACATGAATGG + Intronic
998286524 5:140867405-140867427 ATTCTGTATTAAAAAATTAAAGG - Intronic
998956940 5:147448305-147448327 TCTCTGTATCAAAAGTTCAAAGG + Intronic
999098887 5:149005826-149005848 CCACTATATTAAGAGATTAAGGG + Intronic
1000211880 5:159114916-159114938 GATGTGTATGAAGAGATTAATGG + Intergenic
1000315891 5:160090680-160090702 ACTCATAATGAAAAGATTAATGG - Intronic
1000459309 5:161493849-161493871 TCACTATATGAATAGATTAAAGG - Intronic
1000893305 5:166825194-166825216 CATTTATATGAAAAGTTTAAGGG + Intergenic
1002953669 6:1841138-1841160 CCTATGTAGTAAAAGAATAAGGG + Intronic
1004009781 6:11672693-11672715 TCTCTATATGTAAAGATGAAAGG + Intergenic
1005189081 6:23198072-23198094 CTGCTGTATGAAGAGATAAAAGG + Intergenic
1005195418 6:23277427-23277449 CCTTCATATTAAAAGATTAAAGG + Intergenic
1005792895 6:29325324-29325346 CTTCTATATGAAAATTTTAAGGG + Intergenic
1006759232 6:36444460-36444482 CCTCAGAAGGAAAAGATTAATGG - Intronic
1008721905 6:54364247-54364269 CATCTGTATGCAAAGAGAAATGG + Intronic
1009235567 6:61119533-61119555 CCTATACATGTAAAGATTAAAGG - Intergenic
1009713971 6:67363429-67363451 CATGTATATGAAAATATTAATGG - Intergenic
1010900243 6:81419223-81419245 GTTCTGCATGAAAAGATTTAGGG + Intergenic
1011454570 6:87534335-87534357 TCTAAATATGAAAAGATTAATGG - Intronic
1011621892 6:89250946-89250968 CCTGTGTCTGAAAAAAATAAAGG - Intergenic
1011990993 6:93517202-93517224 CCTATGTTTGAAAAAATTAATGG - Intergenic
1012347105 6:98203479-98203501 CATCTGTACAAAAAGATTCATGG - Intergenic
1014426781 6:121316489-121316511 CCTCAGCAAGAAATGATTAAGGG + Intronic
1015645677 6:135385590-135385612 CATCTGTCTGAAAACATTATTGG + Intronic
1016949224 6:149564643-149564665 CGTCTATATGAAAAGATAATAGG - Intergenic
1017366678 6:153649859-153649881 CATCTGTTTGGATAGATTAAAGG - Intergenic
1020663452 7:11009282-11009304 CCCCTGTGTGAAAAGCTGAATGG + Intronic
1022399217 7:30020757-30020779 CTACTGTATGTAAATATTAAAGG + Intronic
1023580971 7:41682120-41682142 CCGCTGTATGAAAACATTCTGGG - Intergenic
1024782015 7:52861990-52862012 CTTCTGTATAAAATGAGTAAAGG + Intergenic
1025218533 7:57082659-57082681 ACTCAGTCTGACAAGATTAAAGG - Intergenic
1025629457 7:63256276-63256298 ACTCAGTCTGACAAGATTAAAGG - Intergenic
1025652814 7:63487803-63487825 ACTCAGTCTGACAAGATTAAAGG + Intergenic
1029938202 7:104450997-104451019 CCTCTGTATGAAAGGGTGAAGGG - Intronic
1030459504 7:109813902-109813924 CCTCTGGAGGAAAACATAAAAGG - Intergenic
1030474257 7:110008909-110008931 TCTCTGTATGAATTTATTAATGG + Intergenic
1031940304 7:127781865-127781887 CCCCTCTATGAAACGATTACTGG - Intronic
1032599886 7:133282152-133282174 CCTCTTTTGGAAAAGATAAAGGG - Intronic
1035495821 7:159325039-159325061 AGTCTGTTTGAAAAGATAAAGGG - Intergenic
1035853823 8:2951044-2951066 CCTCTCTGTGAAAAGATAACAGG + Intronic
1035938669 8:3871655-3871677 CCTCTGTATGAAAAGATTAAAGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1040349338 8:46548312-46548334 ACTGTGAATGAAAAGATCAATGG - Intergenic
1041770710 8:61469679-61469701 CATCTATATGAAAAGAATAAGGG + Intronic
1042693737 8:71532636-71532658 CATCTTTCTGAAAAGATCAAAGG + Intronic
1043228436 8:77765688-77765710 CCTATTTATGATAAGTTTAAAGG + Intergenic
1043326185 8:79054712-79054734 CCTTAAAATGAAAAGATTAATGG + Intergenic
1046126126 8:109910571-109910593 CCTCAGAATGTAAAGATTACTGG + Intergenic
1046171345 8:110511605-110511627 CCTTTGCTTTAAAAGATTAATGG + Intergenic
1048535899 8:135294188-135294210 CCTTTGTTATAAAAGATTAAAGG - Intergenic
1052029086 9:23608386-23608408 TCTGTGTATGAAAAGAGAAATGG - Intergenic
1052606200 9:30705250-30705272 CCTCAGGATCAAAAGATTAAAGG - Intergenic
1053229834 9:36398859-36398881 GCTCAGTATGGAAAGATTATTGG - Intronic
1054740572 9:68801986-68802008 TCTCTGGATGAGAAGATTGATGG + Intronic
1055379173 9:75687672-75687694 CCGCTGTATGAAAATATATAGGG - Intergenic
1057514824 9:95712245-95712267 CCTCTGGATGAAAAGATAACTGG + Intergenic
1059188320 9:112298010-112298032 TCTTTGTATGAAGACATTAAAGG + Intronic
1059836265 9:118157371-118157393 TCTATTTATGAAAAGATTATAGG - Intergenic
1186241594 X:7573627-7573649 CATCTGTATCAAAAGATAAAAGG + Intergenic
1187225538 X:17372908-17372930 CCTCTGTAAGATATGAATAAAGG - Intergenic
1187323846 X:18268185-18268207 CTACTTTATGAGAAGATTAAAGG + Intronic
1188214746 X:27462698-27462720 CATTTGTATGAAATTATTAAGGG - Intergenic
1188406941 X:29823141-29823163 CATATGCATGATAAGATTAAAGG + Intronic
1190488005 X:50949058-50949080 CCACAGTATGGAAAGATTGAAGG + Intergenic
1193740669 X:85213917-85213939 CCTCAGTAAGAAAAGAGGAAAGG + Intergenic
1194313487 X:92342910-92342932 CATCTATAAGAAAAGATAAATGG - Intronic
1195725352 X:107909621-107909643 CGTTTGTTTGAAAAGCTTAAGGG - Intronic
1196711172 X:118764496-118764518 CCTCTGTATGAAATATTGAAAGG + Intronic
1197022216 X:121705393-121705415 CCTTTGTATGAAGAGATTTTAGG + Intergenic
1198513288 X:137376112-137376134 CATATGAATGAAAAGAGTAAAGG + Intergenic