ID: 1035942078

View in Genome Browser
Species Human (GRCh38)
Location 8:3912689-3912711
Sequence ATGCAGAATACGACAACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035942077_1035942078 23 Left 1035942077 8:3912643-3912665 CCTCAAGTGGAAAAAAGTGGAGC 0: 1
1: 0
2: 0
3: 8
4: 169
Right 1035942078 8:3912689-3912711 ATGCAGAATACGACAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035942078 Original CRISPR ATGCAGAATACGACAACTGA TGG Intronic
No off target data available for this crispr