ID: 1035942160 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:3913424-3913446 |
| Sequence | TTCCCTTCGCTGGTTGCTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035942160_1035942165 | 12 | Left | 1035942160 | 8:3913424-3913446 | CCAGAAGCAACCAGCGAAGGGAA | No data | ||
| Right | 1035942165 | 8:3913459-3913481 | GACTGGAAGAAGCAAGCCCTTGG | No data | ||||
| 1035942160_1035942162 | -5 | Left | 1035942160 | 8:3913424-3913446 | CCAGAAGCAACCAGCGAAGGGAA | No data | ||
| Right | 1035942162 | 8:3913442-3913464 | GGGAAATGTAACCTCCAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035942160 | Original CRISPR | TTCCCTTCGCTGGTTGCTTC TGG (reversed) | Intronic | ||